Skip to main content
Download PDF

Development and evaluation of a novel fast broad-range PCR and sequencing assay (FBR-PCR/S) using dual priming oligonucleotides targeting the ITS/LSU gene regions for rapid diagnosis of invasive fungal diseases: multi-year experience in a large Canadian healthcare zone

BMC Infectious Diseases volume 22, Article number: 375 (2022) Cite this article

Abstract

Background

This study evaluated the performance of a novel fast broad range PCR and sequencing (FBR-PCR/S) assay for the improved diagnosis of invasive fungal disease (IFD) in high-risk patients in a large Canadian healthcare region.

Methods

A total of 114 clinical specimens (CS) including bronchoalveolar lavages (BALs) were prospectively tested from 107 patients over a 2-year period. Contrived BALs (n = 33) inoculated with known fungi pathogens were also tested to increase diversity. Patient characteristics, fungal stain and culture results were collected from the laboratory information system. Dual-priming oligonucleotide (DPO) primers targeted to the internal transcribed spacer (ITS) (~ 350 bp) and large subunit (LSU) (~ 550 bp) gene regions were used to perform FBR-PCR/S assays on extracted BALs/CS. The performance of the molecular test was evaluated against standard microbiological methods and clinical review for the presence of IFD.

Results

The 107 patients were predominantly male (67, 62.6%) with a mean age of 59 years (range = 0–85 years): 74 (69.2%) patients had at least one underlying comorbidity: 19 (34.5%) had confirmed and 12 (21.8%) had probable IFD. Culture recovered 66 fungal isolates from 55 BALs/CS with Candida spp. and Aspergillus spp. being most common. For BALs, the molecular assay vs. standard methods had sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV), and efficiency of 88.5% vs.100%, 100% vs. 61.1%, 100% vs. 88.5%, 61.1% vs. 100%, and 90.2% for both. For other CS, the molecular assay had similar performance to standard methods with sensitivity, specificity, PPV, NPV and efficiency of 66.7%, 87.0%, 66.7%, 87.0% and 81.3% for both methods. Both methods also performed similarly, regardless of whether CS stain/microscopy showed yeast/fungal elements. FBR-PCR/S assays results were reported in ~ 8 h compared to fungal cultures that took between 4 and 6 weeks.

Conclusions

Rapid molecular testing compared to standard methods have equivalent diagnostic efficiency but improves clinical utility by reporting a rapid species-level identification the same dayshift (~ 8 h).

Peer Review reports

Background

Invasive fungal disease (IFD) has increased significantly in the last few decades due to the expansion of patients with acquired immunosuppression [1,2,3,4]. IFD results in increased morbidity and mortality and higher healthcare costs [5,6,7,8,9,10]. Delayed diagnosis is associated with poor clinical outcomes because appropriate treatment measures are not promptly started [1, 11, 12]. However, IFD is often difficult to diagnose because clinical and radiographic findings are non-specific [4]. Traditional microbiological methods such as fungal culture also have low sensitivity ranging from 30 to 60% [13, 14], and the lack of concordance between histopathology and cytology examination and culture is well documented [15,16,17].

Molecular methods including broad-range PCR followed by sequencing are increasingly being used for definitive identification of fungal pathogens and improved diagnosis of IFD [4, 14, 18]. The aim of this study was to identify unique primer candidates for broad-range amplification of the fungal internal transcribed spacer (ITS) and large subunit (LSU) gene regions to use in a fast PCR/sequencing assay that could be rapidly completed in a clinical laboratory. Prior studies evaluating panfungal PCR assays have relied on conventional primers targeted to one or more regions of the fungal multi-copy ribosomal RNA (rRNA) such as 18S rRNA, D1and D2 regions of 28 s rRNA, 5.8S rRNA, and internal transcribed spacers 1 and 2 (ITS1 and ITS2) with variable success [19,20,21,22,23,24,25,26,27,28]. We designed a new primer pair based on the dual priming oligonucleotide (DPO) principle because of our success with this approach in previously implementing a broad-range 16S rRNA PCR/sequencing assay with robust sensitivity and improved specificity due to elimination of cross-reactivity with human material [29]. A DPO consists of two functional segments with distinct annealing properties connected by five consecutive deoxyinosine bases or a poly (I) linker; (1) a 5’ segment (18–25 bp) allows for stable positioning and annealing of the primer, and (2) a shorter segment (6–12 bp) that will only bind if there is stable annealing of the 5’ end to ensure target-specific extension [30] Diagnostic performance of our novel fungal FBR-PCR/S assay was compared to standard microbiological methods already in use in our laboratory (i.e., morphology, fungal culture with identification using matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) and PCR/sequencing using conventional ITS 1/2 universal primers). A recommended algorithm is provided for clinical laboratories to allow reporting the same day by efficient integration of technologists’ workflow for simultaneously performing bacterial and fungal broad-range PCR/cycle sequencing assays within a standard ~ 8 h dayshift.

Materials and methods

Patients and clinical specimens

Patients with and without suspected non-invasive and IFD were prospectively enrolled over a 2-year period (2016–18) from the Calgary Zone, Alberta Health Services (AHS) based on combined concern of the consulting Infectious Diseases physician for IFD, and the results of microbiological analyses of clinical specimens. Cases were categorized as having proven probable or possible IFD or no fungal disease based on consensus definitions recently published by the European Organization for Research and Treatment of Cancer and the Mycoses Study Group Education and Research Consortium (EORTC/MSGERC) following clinical review by medical microbiologists (MG and JC) and an infectious diseases specialist (DLC) [4].

Sterile fluid and tissue specimens were enrolled by the microbiology laboratory (Clinical Section of Microbiology, Calgary Laboratory Services (CLS; now Alberta Precision Laboratories) after quality approval by a medical microbiologist (DLC/TG/MG). Study specimens were stored at − 80 to − 86 °C before analyses. Stored clinical specimens and contrived bronchoalveolar lavages (BALs) were used for pre-clinical validation of the molecular assay. Contrived BAL specimens were prepared to simulate a heavily infected sample (up to 35 ng DNA). DNA was extracted from spent fungal-negative BAL specimens inoculated with known pathogens (n = 33) obtained from our reference mycology laboratory [Provincial Laboratory Northern Alberta (PLNA), Edmonton, AB] including: Aspergillus lentulus (n = 1), A. terreus (n = 3), A. flavus (n = 3); Absidia corymbifera (n = 3); Fonsecaea pedrosoi (n = 2); Fusarium solani (n = 2), F. proliferatum (n = 1); Cladosporium carrionii (n = 2) and Cladosporium spp. (n = 1); Cunninghamella bertholletiae (n = 2) and one undetermined Cunninghamella spp.; Rhizopus aarhizus (n = 1), R. microsporus (n = 1), R. stolonifera (n = 1), and three undetermined Rhizomucor spp.; Trichosponon asahii (n = 1) and one undetermined Trichosporon spp.; and Malassezia furfur (n = 2), M. pachydermatis (n = 1).

Microbiological analyses

Clinical specimens were analyzed by standard microscopic examination and fungal culture methods. Yeast isolates were identified by microscopic examination, and matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS) (Vitek MS, bioMérieux, Laval, Quebec). Molds were identified using colony morphology, microscopic examination and conventional PCR using the internal transcribed spacer or ITS gene regions (including universal ITS1 and ITS2) as previously described by White and colleagues [31]. Identification of fungal isolates provided by the PLNA reference laboratory was confirmed using the MicroSEQ™ D2 rDNA Fungal PCR and Sequencing Kit (Applied Biosystems, Thermo Fisher Scientific).

Molecular methods

  1. a.

    Controls

A clinical isolate of Saccharomyces cerevisiae positive for both ITS2 and LSU targets was used as the positive control for all molecular procedures (See Fig. 1—Positive Extraction control or PEC). The negative extraction control (i.e., extraction reagents only; NEC) was processed and extracted alongside all clinical and contrived specimens throughout all FBR-PCR/S assay procedures (See Fig. 1—NEC).

  1. b.

    DNA Extraction

Fungal isolates obtained from the reference laboratory were extracted in TE buffer using glass bead beating. Nucleic acid DNA concentration was determined by a Nanodrop spectrophotometer (Thermo-Fisher Scientific, Mississauga, ON). A total of 500 ng DNA was eluted into 100 µL of TE buffer giving a final template concentration of 5 ng/µL to give reliable detection. Contrived specimens (n = 33) consisted of 500 ng reference isolate DNA added to 400 µL of spent culture-negative BAL fluid from spent clinical specimens whose clinical analyses were complete. Clinical and contrived specimens were extracted using the QIAmp UCP Pathogen Mini Kit (Canada-QIAGEN, Toronto, CA) according to the manufacturer’s protocol. Tissues had an extended Proteinase K incubation time, otherwise both tissue and fluid protocols were the same. Tissue specimens (2–4 mm3) were finely minced with a sterile scalpel, transferred to a sterile 1.5 mL microcentrifuge tube, re-suspended in 400 µL Buffer ATL and 40 µL Proteinase K, vortexed, and incubated at 56 °C in a 1000 rpm Eppendorf thermomixer for 1 h until digested. Sterile fluid specimens (at least 400 µL) were placed into a sterile 1.5 mL microcentrifuge tube, centrifuged, supernatant discarded, cell pellet re-suspended in Buffer ATL, Proteinase K, vortexed, and incubated at 56 °C in a 1000 rpm Eppendorf thermomixer for a minimum of 10 min. Purified, eluted DNA was stored at − 20 °C until use.

  1. c.

    FBR-PCR/S Assay

DPO primers (26, 27) targeted towards the Internal Transcribed Spacer (ITS) regions and the Large Subunit (LSU) of the nuclear ribosomal RNA (rRNA) gene complex were designed by the investigators (BC and DLC) after multisequence alignment of several hundred GenBank sequences of multiple genera to identify candidate conserved regions. DPO primers were purchased from Exiqon (Woburn, MA). All other primers were purchased from Integrated DNA Technologies (IDT, Coralville, Iowa). FBR-PCR used a forward primer [ITS3DPO_F3: 5′ CAT CGA TGA AGA RCG YA-I-I-I-I-I-I-TGCGA 3′ (I = deoxyinosine; R = A/G, Y = C/T)], and two reverse primers, for ITS detection [ITS4DPO_R5: 5′ TAT TGA TAT GCK TAA-I-I-I-I-I-G CGG GT 3′ (K = G/T), and LSU detection [LSUDPO3_R: 5′ GAC TCC TTG GTC CGT-III-II-AAG AC 3′. PCR for human-β-globin gene was performed in parallel as a control using β-glob-F [GAAGAGCCAAGGACAGGTAC] and β-glob-PC04R [CAACTTCATCCACGTTCACC] in a final concentration of 0.3 µM.

Fig. 1
figure 1

Electrophoresis Gel Image of FBR-PCR/S Assaya. aFBR-PCR/S assay gel image: Lane 1: 100 bp ladder; Lane 2: Clinical sample; Lane 3: Positive Extraction Control (PEC) (S. cerevisiae); Lane 4: Negative Extraction Control (NEC). a Top Panel: Fungal Broad-range (FBR) Panfungal PCR targeting ITS and LSU gene regions. FBR PCR shows two bands, ~ 350 bp ITS band and ~ 900 bp band corresponding to combined amplification of ITS (~ 350 bp) and LSU (~ 600 bp) targets. b Lower Panel: human β-globin PCR. Human clinical sample shows a strong ~ 300 bp band, indicating successful DNA extraction

Full size image

Fast-PCR was set up with the Molyzm 16S basic (Molzym, Bremen, Germany) kit reagents. The 30 µL reaction contained 7 µL of template DNA and final concentration of 0.3 µM ITS3DPO_F3 forward primer and 0.2 µM each of ITS4DPO_R5 and LSUDPO3_R reverse primer. FBR-PCR was performed on a Veriti thermocycler (Life Technologies, Carlsbad, CA) under the following cycling conditions: 5 min. initial denaturation at 95 °C, followed by 35 cycles of 94 °C for 10 s, 54 °C for 15 s and 72 °C for 25 s, with a final extension of 72 °C for 5 min. PCR product was electrophoresed on a 1.5% agarose gel containing SYBRsafe (Life Technologies). During the PCR reaction, the ITS3DPO_F3/ITS4DPO-R5 F/R primer pair amplify a ~ 350 bp ITS amplicon, whereas the ITS3DPO_F3/LSUDPO_3R F/R primer pair amplify the ITS region (~ 350 bp) plus ~ 500–600 bp of the LSU region. The ~ 900 bp amplicon therefore represented a combined ITS/LSU fragment. Agarose gel electrophoresis confirmed the amplification of fungal DNA: PCR products displaying a band in the expected ~ 350 bp region for ITS, and ~ 900 bp region for ITS/LSU were then purified by Exo-SAP-it (Affymetrix, Santa Clara, CA) (Fig. 1).

Assay level of detection (LoD) was determined using two well characterized isolates; Aspergillus brasiliensis (ATCC 16404) and Candida albicans (ATCC 10231). Briefly, DNA was extracted in a 1.5 mL microfuge containing ~ 0.2 g of zirconium beads (BioSpec) and 10 mM Tris-1 mM EDTA pH 8.0 buffer and subsequently boiled at 100 °C for 10 min. to inactivate the organisms. Bead beating at 5 m/s for 120 s occurred in a Beadmill 4 instrument (Fisher Scientific) before centrifugation to pellet the debris and transfer of the supernatant to a fresh tube. A Nanodrop spectrophotometer (ThermoFisher) was used to measure the DNA concentration before subsequent 1/100 dilution with nuclease-free water to make a working solution. Copy number equivalents for each organism were calculated by using the genome size information by ATCC. LoD was then determined by a twofold serial dilution series of contrived negative BAL prepared with inoculation of either known amounts of ATCC 10231 or ATCC 16404 as follows: (1) “4 N” (4 × 10^5 copies/mL), (2) “2 N” (2 × 105 copies/mL), (3) “D2” (5 × 104 copies/mL), and 4) “D8” (1.25 × 104 copies/mL). DNA was extracted from 400 μL of each contrived BAL specimen in the dilution series with the UV-irradiated Qiagen DNA mini kit (Qiagen) performed in triplicate. FBR-PCR was performed on each contrived BAL specimen as outlined above. Agarose gel electrophoresis confirmed the amplification of fungal DNA: PCR products displaying a band in the expected ~ 350 bp region for ITS, and ~ 900 bp region for ITS/LSU were then purified by Exo-SAP-it (Affymetrix, Santa Clara, CA). The dilution series established the LoD for the FBR-PCR assay for both C. albicans and A. brasiliensis as < 360 to > 175 copies/mL.

Molecular identification of the ITS and LSU rDNA product(s) was done by Sanger sequencing of the ITS and/or LSU rDNA product using BigDye Terminator v1.1 Cycle Sequencing Kit (Life Technologies) on an ABI Prism 3500XL sequencer (Life Technologies). The ITS3DPO_F3/ITS4DPO-R5 F/R primer pair was used to sequence the ITS region and the LSU-Fseq [AGTARCGGCGAGTGAAG]/ LSUDPO3_R F/R primer pair were used to sequence the LSU region. A BLAST search against the IDNS Fungal database (SmartGene IDNS, Lausanne, Switzerland) provided a definitive identification of the organism to the genus- or species-level using the identify scores outlined by the Clinical Laboratory Standards Institute, Approved Guidelines MM-18 [32].

Data analysis

Data were entered into a Microsoft Excel spreadsheet (MS Office 2016) and analyzed according to standard descriptive statistics. A 2 X 2 contingency table was used to calculate the sensitivity, specificity, positive and negative predictive values were calculated against internationally recognized diagnostic criteria for the presence of IFD [4]. FBR-PCR/S performance was calculated against standard methods (i.e., fungal culture on all samples followed by identification of yeasts by morphology/MALDI-TOF MS and molds by morphology/conventional PCR targeted to the ITS1 and ITS 2 gene regions. Invalid FBR-PCR/S results were defined as a weakly positive electrophoresis band in either of the ITS/LSU fungal targets with no quality sequence subsequently obtained. In patients with confirmed, probable or possible IFD the following performance criteria were assigned for the FBR-PCR/S assay: (1) a true positive result agreed with that of standard methods, (2) a false-negative or false-positive result was considered discordant with standard methods, and in patients with no evidence of IFD, a true negative result agreed with standard methods. Resolution of discordant results occurred by repeat FBR-PCR/S testing, repeat PCR testing using conventional PCR targeted to the ITS1 and ITS 2 gene regions, and clinical review.

Results

Patient characteristics and specimens

A total of 107 enrolled patients were predominantly male (67, 62.6%), had a mean age of 59 years (range = 0–85 years) with no significant age difference according to gender. Comorbidities in five patients were unknown due to missing data. Most patients (74/107, 69.2%) had at least one underlying comorbidity that predisposed them to IFD including diabetes mellitus (18/74, 24.3%), solid-organ malignancy/tumour (18/74, 24.3%), immunosuppressive therapy for non-malignant conditions (13/74, 17.6%), hematologic malignancy (12/74, 16.2%), hematopoietic stem cell transplant (HSCT) (5/74, 6.7%), HIV/AIDs (4/74, 5.4%), and end-stage renal disease (2/74, 2.7%). A total of 54/74 (73%) had clinical evidence for IFD including 19 patients (17.8%) with confirmed IFD, 12 (11.2%) with probable IFD, and 27 (%) with possible IFD. True positive molecular tests were found in a third of patients (15/54, 27.8%) with confirmed or probable IFD.

A total of 114 clinical specimens were tested from these patients including 39 (34.2%) BALs and 75 (65.8%) other types of sterile fluids and tissues; 7 patients had ≥ 2 specimens tested (Table 1). BALs and other pulmonary specimens (lung/bronchial/pleural aspirates or fluids) (n = 51, 44.7%) were the most tested sterile fluids. A wide range of different tissue types were tested representing the disseminated nature of IFD. A total of 55 (48.2%) specimens had yeast/fungi recovered by standard methods. Twenty (17.5%) specimens only had bacterial cultures done because yeast/fungal culture was not initially ordered—most of these specimens (n = 16, 80%) had negative Gram and CW stains and bacterial cultures, but 1 BAL and 2 abdominal fluid specimens grew Candida albicans (despite negative CW), 1 abdominal fluid showed yeast in the Gram stain and grew C. albicans, and 1 sinus aspirate grew Aspergillus fumigatus.

Table 1 Clinical specimens tested in validation of broad range fungal PCR/sequencing assay
Full size table

Fungi identified from contrived and clinical specimens

The FBR-PCR/S assay accurately identified 32/33 (97%) of the yeast/fungi inoculated into the contrived BAL specimens except for one specimen containing A. terreus (See Methods). Another sixty-six fungal isolates were recovered from fifty-five clinical specimens. Candida spp. (n = 36, 54.5%) [C. albicans (n = 18), C. dublinensis (n = 4), C. glabrata (n = 5), C. kefyr (n = 3), C. krusei (n = 2), C. parapsilosis (n = 1) and C. tropicalis (n = 2)] and Aspergillus spp. (n = 14, 16.7%) [A. flavus (n = 2), A, fumigatus (n = 7), A. terreus (n = 1), A. niger (n = 1), and 3 other Aspergillus spp.] was the most identified species. Other fungal species identified included Alternaria spp. (n = 1), Coccidioides immitis (n = 2), Cryptococcus neoformans (n = 1), Exophilia dermatiditis (n = 1), Fonsecaea spp. (n = 1), Fusarium merismoides (n = 1), Histoplasma capsulatum (n = 1), Penicillium spp. (n = 2), Pseudallescheria boydii complex (n = 2), Trichophyton rubrum (n = 1) and Rhizopus oryzae (n = 3). One BAL sample was also PCR positive for Pneumocystis jirovecii using specific PCR primers.

Resolution of discrepant results

Discordant results were initially observed in 30 clinical specimens including 16 BALs and 14 other types of clinical specimens. Tables 2, 3 details the resolution of discrepant results. Of the 30 discordant results, 19 (63.3%) specimens [BALs (n = 10) and other clinical specimens (n = 9)] were resolved in favour of the molecular assay results (Table 2), while 11(36.7%) specimens [BALs (n = 6) and other clinical specimens (n = 5)] were resolved in favour of standard methods (Table 3). BALs were prone to contamination from patient’s airway colonization with Candida spp. and/or Aspergillus spp., which gave initial discrepant results, but most were resolved in favour of the FBR-PCR/S result after repeat testing and clinical review (Table 2).

Table 2 Discrepant clinical specimens resolved in favour of molecular assay (true positive or negative by PCR/sequencing)
Full size table
Table 3 Discrepant Clinical Specimens Resolved in Favour of Standard Methods (False Positive or Negative by PCR/Sequencing)a
Full size table

FBR-PCR/S analysis made a critical difference to patient management and clinical outcome in 4 unusual cases where fungal cultures were negative (Table 2).

Molecular assay performance

The performance of the molecular assay compared to standard methods is shown in Table 4 for BALs, and Table 5 for other clinical non-BAL specimens. The molecular assay and standard methods had similar diagnostic efficiency for both BAL (90.2%) and non-BAL specimens although both approaches had lower diagnostic efficacy (81.3%) for non-BALs.

Table 4 Performance of molecular assay and standard methods for bronchoalveolar lavage specimens (Clinical and Contrived)a
Full size table
Table 5 Performance of molecular assay and standard methods for other types of clinical specimens (non-BALs)a
Full size table

Both diagnostic approaches also had similar performance in clinical specimens that showed fungal elements on microscopic examination after CW staining (Table 6). Although a negative CW stain and microscopic examination has excellent specificity and NPV, it has poor sensitivity and PPV for fungal infection. Microscopy negative BALs and other clinical specimens were negative by standard methods and FBR-PCR/S. Clinical specimens positive by microscopy (n = 10, 8.8%) demonstrated variable culture and/or PCR positivity; 6 specimens were positive by both methods, 2 were only positive by culture, and 2 were only positive by PCR. Another fifty-six (49.1%) specimens were microscopy negative but grew a variety of yeast/fungi and demonstrated variable culture and/or PCR positivity; 37 were positive by both methods, 14 were only positive by culture and 5 were only positive by PCR.

Table 6 Performance of molecular assay and standard methods compared to microscopy for clinical specimens including contrived BALsa
Full size table

Implementation of the molecular assay

Figure 2 shows an algorithm for the FBR-PCR/S procedure workflow and the time required for each assay step to report results in ~ 8 h or within the technologist’s dayshift; divided between specimen processing/extraction and fast PCR amplification/gel interpretation (~ 4.5 h) and fast cycle sequencing and interpretation (~ 3.5 h) (Fig. 2). Due to the longer sequence length provided by the LSU primers (> 550 bp) this would be the preferred single target for initial detection followed by ITS (~ 350 bp). To ensure an optimal pre-test probability and the quality and quantity of specimen available, FBR-PCR/S tests are ordered by the Infectious Diseases service in consultation with a medical microbiologist.

Fig. 2
figure 2

Algorithm for FBR-PCS/S Assay with Timing for Key Steps

Full size image

Discussion

Our study is the first to evaluate the diagnostic performance of a novel broad-range panfungal PCR/sequencing assay using DPO primers and fast protocols in a non-selected patient population with and without confirmed, probable of possible IFD in a large Canadian health region. This approach allows equivalent or improved diagnostic performance compared to previous reports from other studies that evaluated panfungal PCR assays in both selected and non-selected patient populations and clinical specimens [19,20,21,22,23,24,25,26,27,28]. Our FBR-PCR/S assay has increased specificity compared other panfungal PCR assays and provides a rapid same day diagnosis of IFD. Our molecular assay had an excellent performance compared to culture in microscopy positive specimens, and an equivalent performance in microscopy negative specimens. IFD were diagnosed by FBR-PCR/S analysis of microscopy negative specimens indicating a role for this diagnostic approach for non-selected patients without overt immunosuppression. Rampini and colleagues (2016/Switzerland) [20] have also demonstrated similar efficacy of their fungal ITS PCR compared to conventional methods for diagnosing fungal infections in non-immunocompromised patients. They evaluated 251 clinical specimens using both the fungal ITS PCR compared to fungal culture and demonstrated a high concordance of 89.6% and equivalent analytical performance with a sensitivity, specificity, PPV and NPV of 87.7%, 90.3%, 76% and 95.5% respectively [20].

Previous reports of FBR-PCR/S evaluations in non-selected clinical cases have been limited, and primarily reported from large laboratories in Europe of the United States [19, 22, 24, 33]. Lass-Florl and colleagues (2013/Austria) [19] evaluated an ITS fungal PCR in 206 tissues and sterile fluid samples (n = 190 patients) with negative microscopy and found a sensitivity, specificity, PPV and NPV of 57.1%, 97%, 80% and 91.7%. Valero and colleagues (2016/Spain) [24] developed a fungal PCR using two ITS primers and 4 probes targeted to specific fungal pathogen groups, which showed comparable sensitivity (83.3%) and specificity (100%) to our assay. Zeller and colleagues (2017/Austria) [21] evaluated an ITS fungal PCR in 105 tissues and sterile fluids (n = 98 patients) and found a sensitivity, specificity, PPV and NPV of 87.7%, 90.3%, 76% and 95.5% respectively. Gomez and colleagues (2017/USA) [23] used a dual target (i.e., ITS 2 and D2 region of 28S) to evaluate 117 tissues and sterile fluids from 117 patients with confirmed IFD compared to 116 clinical samples from 108 patients with suspected IFD. Performance of their fungal PCR assay was better in the targeted IFD group [sensitivity (96.6%) and specificity (98.25%)] than in patients suspected of IFD [sensitivity (62.8%) and specificity (71.3%)] [22]. Ala-Houhala and colleagues (2017/Finland) [22] used a dual target ITS fungal PCR to test 37 tissue and sterile fluid specimens from 279 patients and found a sensitivity, specificity, PPV and NPV of 60.5%, 91.7%, 54.2% and 93.4% respectively. Stempak and colleagues (2019/USA) [33] also showed that fungal PCR testing had equivalent performance on analyses of 65 sterile fluid and tissue samples selected based on having all reference methods done (i.e., stains, DNA probes, culture, histopathology). However, several studies discourage the routine use of panfungal PCR testing, particularly on BALs, because no IFD cases were found that were not diagnoses by the reference methods, and due to environmental contamination the results may be difficult to interpret [25, 28, 33, 34].

Our molecular assay workflow allows same day reporting of panfungal PCR results allowing for rapid diagnosis and prompt implementation of appropriate management. Use of our panfungal assay improved clinical management and outcomes for several critically ill patients whose prior work-up by standard methods had been repeatedly negative or was delayed due to the extended incubation required of fungal culture isolate recovery. Clinical laboratories may also provide a similarly rapid 16S broad-range PCT/sequencing result (~ 8 h) by implementing molecular assays based on DPO primers for both bacteria and fungal pathogens with our recommended integrated workflow.

Our study had several limitations including the small number of specimens across the various types and sources enrolled. Because Candida spp. and Aspergillus spp. are the most commonly isolated fungi from BAL and non-BAL specimens in clinical microbiology laboratories worldwide, we used contrived BAL specimens to broaden the evaluation of the FBR-PCR/S assay. Due to the inherently high rate of contamination by fungal commensals present in clinical samples, interpretation of both standard methods compared to panfungal PCR results may be challenging without clinical review as shown by the initial rate of discordant results in this study. BALs or other pulmonary samples were most contaminated by commensal fungi in the patient’s airway, particularly Candida spp., Penicillium spp. and Aspergillus spp., which occurs during collection. But as previously reported [25, 28, 34], this problem is not unique to our study. Panfungal PCR alone may also not be optimal for diagnosing polymicrobial fungal infections because mixed sequencing results may not be interpretable. A more detailed clinical assessment by chart review would have allowed a more accurate clinical assessment for the presence of IFD.

Conclusions

Rapid panfungal FBR-PCR/S testing has equivalent diagnostic efficiency compared to standard methods with improved specificity, but our novel assay improves clinical utility by reporting a rapid species-level identification the same dayshift (~ 8 h).

Availability of data and materials

The data that support the findings of this study are available from Alberta Health Services (AHS), Alberta Precision Laboratories (APL) (formerly CLS) but restrictions apply to the availability of these data, which were used under the ethics agreement for the current study, and so are not publicly available. Data are however available from the author upon reasonable request and with permission of AHS/APL.

Abbreviations

FBR-PCR/S:

Fast broad range PCR and sequencing

PCR:

Polymerase chain reaction

BAL:

Bronchoalveolar lavage

CS:

Clinical specimens

CSF:

Cerebrospinal fluid

IFD:

Invasive fungal diseases

CW:

Calcofluor white stain

ITS:

Internal transcribed spacer region

LSU:

Large subunit region

DNA:

Deoxyribonucleic acid

NEC:

Negative extraction control

PEC:

Positive extraction control

DPO:

Dual priming oligonucleotides

IMA:

Inhibitory mold agar

BHI:

Brain heart infusion agar

BHIA:

Brain heart infusion agar with antibiotics

BCYE:

Buffered charcoal yeast extract agar

HIV/AIDS:

Human immunodeficiency virus/acquired immunodeficiency syndrome

HSCT:

Hematopoietic stem cell transplant

SOT:

Solid organ tumour

PPV:

Positive predictive value

NPV:

Negative predictive value

PEC:

Positive extraction control

References

  1. Ford ES, Duke ER, Cheng GS, Yoke LM, Liu C, Hill JA, Pergam SA, Pipavath SNJ, Walter RB, Mielcarek M, et al. Outcomes of hematopoietic cell transplantation in patients with mixed response to pretransplantation treatment of confirmed or suspected invasive fungal infection. Transplant Cell Ther. 2021;27:684.

    Article  PubMed  Google Scholar 

  2. Tey A, Shaw B, Cardamone L, Shepherd S, Paul E, Rogers B, Shortt J. Risk factors for invasive fungal infection in 5-azacytidine treated patients with acute myeloid leukemia and myelodysplastic syndrome. Eur J Haematol. 2021;107:181.

    Article  CAS  PubMed  Google Scholar 

  3. Rinaldi M, Bartoletti M, Ferrarese A, Franceschini E, Campoli C, Coladonato S, Pascale R, Tedeschi S, Gatti M, Cricca M, et al. Breakthrough invasive fungal infection after liver transplantation in patients on targeted antifungal prophylaxis: a prospective multicentre study. Transpl Infect Dis. 2021;23:e13608.

    CAS  PubMed  PubMed Central  Google Scholar 

  4. Donnelly JP, Chen SC, Kauffman CA, Steinbach WJ, Baddley JW, Verweij PE, Clancy CJ, Wingard JR, Lockhart SR, Groll AH, et al. Revision and update of the consensus definitions of invasive fungal disease from the European organization for research and treatment of cancer and the mycoses study group education and research consortium. Clin Infect Dis. 2020;71(6):1367–76.

    Article  PubMed  Google Scholar 

  5. Li Y, Gao Y, Niu X, Wu Y, Du Y, Yang Y, Qi R, Chen H, Gao X, Song B, et al. A 5-year review of invasive fungal infection at an academic medical center. Front Cell Infect Microbiol. 2020;10:553648.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Hosseini-Moghaddam SM, Ouedraogo A, Naylor KL, Bota SE, Husain S, Nash DM, Paterson JM. Incidence and outcomes of invasive fungal infection among solid organ transplant recipients: a population-based cohort study. Transpl Infect Dis. 2020;22(2):e13250.

    Article  PubMed  Google Scholar 

  7. Ferrarese A, Cattelan A, Cillo U, Gringeri E, Russo FP, Germani G, Gambato M, Burra P, Senzolo M. Invasive fungal infection before and after liver transplantation. World J Gastroenterol. 2020;26(47):7485–96.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Kobayashi R, Hori D, Sano H, Suzuki D, Kishimoto K, Kobayashi K. Risk factors for invasive fungal infection in children and adolescents with hematologic and malignant diseases: a 10-year analysis in a single institute in Japan. Pediatr Infect Dis J. 2018;37(12):1282–5.

    Article  PubMed  Google Scholar 

  9. Corzo-Leon DE, Satlin MJ, Soave R, Shore TB, Schuetz AN, Jacobs SE, Walsh TJ. Epidemiology and outcomes of invasive fungal infections in allogeneic haematopoietic stem cell transplant recipients in the era of antifungal prophylaxis: a single-centre study with focus on emerging pathogens. Mycoses. 2015;58(6):325–36.

    Article  PubMed  Google Scholar 

  10. Neofytos D, Horn D, Anaissie E, Steinbach W, Olyaei A, Fishman J, Pfaller M, Chang C, Webster K, Marr K. Epidemiology and outcome of invasive fungal infection in adult hematopoietic stem cell transplant recipients: analysis of Multicenter Prospective Antifungal Therapy (PATH) Alliance registry. Clin Infect Dis. 2009;48(3):265–73.

    Article  CAS  PubMed  Google Scholar 

  11. Farmakiotis D, Kyvernitakis A, Tarrand JJ, Kontoyiannis DP. Early initiation of appropriate treatment is associated with increased survival in cancer patients with Candida glabrata fungaemia: a potential benefit from infectious disease consultation. Clin Microbiol Infect. 2015;21(1):79–86.

    Article  PubMed  Google Scholar 

  12. Garey KW, Rege M, Pai MP, Mingo DE, Suda KJ, Turpin RS, Bearden DT. Time to initiation of fluconazole therapy impacts mortality in patients with candidemia: a multi-institutional study. Clin Infect Dis. 2006;43(1):25–31.

    Article  CAS  PubMed  Google Scholar 

  13. Ambasta A, Carson J, Church DL. The use of biomarkers and molecular methods for the earlier diagnosis of invasive aspergillosis in immunocompromised patients. Med Mycol. 2015;53(6):531–57.

    Article  CAS  PubMed  Google Scholar 

  14. Arvanitis M, Anagnostou T, Fuchs BB, Caliendo AM, Mylonakis E. Molecular and nonmolecular diagnostic methods for invasive fungal infections. Clin Microbiol Rev. 2014;27(3):490–526.

    Article  PubMed  PubMed Central  Google Scholar 

  15. Tarrand JJ, Lichterfeld M, Warraich I, Luna M, Han XY, May GS, Kontoyiannis DP. Diagnosis of invasive septate mold infections. A correlation of microbiological culture and histologic or cytologic examination. Am J Clin Pathol. 2003;119(6):854–8.

    Article  PubMed  Google Scholar 

  16. Lee S, Yun NR, Kim KH, Jeon JH, Kim EC, Chung DH, Park WB, Oh MD. Discrepancy between histology and culture in filamentous fungal infections. Med Mycol. 2010;48(6):886–8.

    Article  PubMed  Google Scholar 

  17. Sangoi AR, Rogers WM, Longacre TA, Montoya JG, Baron EJ, Banaei N. Challenges and pitfalls of morphologic identification of fungal infections in histologic and cytologic specimens: a ten-year retrospective review at a single institution. Am J Clin Pathol. 2009;131(3):364–75.

    Article  PubMed  Google Scholar 

  18. McCarthy MW, Walsh TJ. PCR methodology and applications for the detection of human fungal pathogens. Expert Rev Mol Diagn. 2016;16(9):1025–36.

    Article  CAS  PubMed  Google Scholar 

  19. Lass-Florl C, Mutschlechner W, Aigner M, Grif K, Marth C, Girschikofsky M, Grander W, Greil R, Russ G, Cerkl P, et al. Utility of PCR in diagnosis of invasive fungal infections: real-life data from a multicenter study. J Clin Microbiol. 2013;51(3):863–8.

    Article  PubMed  PubMed Central  Google Scholar 

  20. Rampini SK, Zbinden A, Speck RF, Bloemberg GV. Similar efficacy of broad-range ITS PCR and conventional fungal culture for diagnosing fungal infections in non-immunocompromised patients. BMC Microbiol. 2016;16(1):132.

    Article  PubMed  PubMed Central  Google Scholar 

  21. Zeller I, Schabereiter-Gurtner C, Mihalits V, Selitsch B, Barousch W, Hirschl AM, Makristathis A, Willinger B. Detection of fungal pathogens by a new broad range real-time PCR assay targeting the fungal ITS2 region. J Med Microbiol. 2017;66(10):1383–92.

    Article  CAS  PubMed  Google Scholar 

  22. Ala-Houhala M, Koukila-Kahkola P, Antikainen J, Valve J, Kirveskari J, Anttila VJ. Clinical use of fungal PCR from deep tissue samples in the diagnosis of invasive fungal diseases: a retrospective observational study. Clin Microbiol Infect. 2018;24(3):301–5.

    Article  CAS  PubMed  Google Scholar 

  23. Gomez CA, Budvytiene I, Zemek AJ, Banaei N. Performance of targeted fungal sequencing for culture-independent diagnosis of invasive fungal disease. Clin Infect Dis. 2017;65(12):2035–41.

    Article  PubMed  Google Scholar 

  24. Valero C, de la Cruz-Villar L, Zaragoza O, Buitrago MJ. New panfungal real-time PCR assay for diagnosis of invasive fungal infections. J Clin Microbiol. 2016;54(12):2910–8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Trubiano JA, Dennison AM, Morrissey CO, Chua KY, Halliday CL, Chen SC, Spelman D. Clinical utility of panfungal polymerase chain reaction for the diagnosis of invasive fungal disease: a single center experience. Med Mycol. 2016;54(2):138–46.

    Article  CAS  PubMed  Google Scholar 

  26. Trabelsi H, Neji S, Hadrich I, Khemakhem N, Sellami H, Makni F, Ayadi A. Contribution of the internal transcribed spacer regions to the detection and identification of human fungal pathogens. Curr Res Transl Med. 2019;67(3):100–6.

    Article  CAS  PubMed  Google Scholar 

  27. Wehrle-Wieland E, Affolter K, Goldenberger D, Tschudin Sutter S, Halter J, Passweg J, Tamm M, Khanna N, Stolz D. Diagnosis of invasive mold diseases in patients with hematological malignancies using Aspergillus, Mucorales, and panfungal PCR in BAL. Transpl Infect Dis. 2018;20(5):e12953.

    Article  PubMed  Google Scholar 

  28. Ricna D, Lengerova M, Bezdicek M, Kocmanova I, Drgona L, Weinbergerova B, Mayer J, Racil Z. Detection and identification of fungi in bronchoalveolar lavage fluid from immunocompromised patients using panfungal PCR. Folia Microbiol (Praha). 2019;64(3):421–8.

    Article  CAS  Google Scholar 

  29. Miller RJ, Chow B, Pillai D, Church D. Development and evaluation of a novel fast broad-range 16S ribosomal DNA PCR and sequencing assay for diagnosis of bacterial infective endocarditis: multi-year experience in a large Canadian healthcare zone and a literature review. BMC Infect Dis. 2016;16:146.

    Article  PubMed  PubMed Central  Google Scholar 

  30. Kommedal O, Simmon K, Karaca D, Langeland N, Wiker HG. Dual priming oligonucleotides for broad-range amplification of the bacterial 16S rRNA gene directly from human clinical specimens. J Clin Microbiol. 2012;50(4):1289–94.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. White TJ, Bruns S, Lee S, Taylor J. Amplification and direct sequencing of fungal ribosomal genes for phylogenetics. In: Innis MA, Gelfand J, Sninsky J, White TJ, editors. PCR Protocols: a guide to methods and Pplications. San Diego: Academic Press; 1990. p. 315–24.

    Google Scholar 

  32. Clinical Laboratory standards Institute (CLSI). Interpretive criteria for identification of bacteria and fungi by DNA target sequencing. Approved Guideline MM-18. Wayne, PA USA:CLSi;2018.

  33. Stempak LM, Vogel SA, Richter SS, Wyllie R, Procop GW. routine broad-range fungal polymerase chain reaction with DNA sequencing in patients with suspected mycoses does not add value and is not cost-effective. Arch Pathol Lab Med. 2019;143(5):634–8.

    Article  PubMed  Google Scholar 

  34. Garnham K, Halliday CL, Kok J, Jayawardena M, Ahuja V, Green W, Chen SC. Knowledge at what cost? An audit of the utility of panfungal PCR performed on bronchoalveolar lavage fluid specimens at a tertiary mycology laboratory. Pathology. 2020;52(5):584–8.

    Article  CAS  PubMed  Google Scholar 

  35. Manji FLJ, Meatherall BL, Church D, Missaghi B. Severe facial necrosis in a type 1 diabetic patient secondary to mucormycosis masquerading as an internal maxillary artery occlusion: a case report. BMC Infect Dis. 2019;19(1):184.

    Article  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

We would like to thank Calgary Laboratory Services (now Alberta Precision Laboratories) for a peer-reviewed research grant to perform this work. The Provincial Laboratory Northern Alberta provided fungal isolates for this study.

Funding

Financial support was provided by a peer-reviewed grant from Calgary Laboratory Services (CLS; now Alberta Precision Laboratories).

Author information

Authors and Affiliations

  1. Department of Pathology and Laboratory Medicine, Cummings School of Medicine, University of Calgary, 3330 Hospital Dr. NW, Calgary, AB, T2N 4B1, Canada

    M. Groeschel, J. Carson, T. Griener & D. L. Church

  2. Department of Medicine, Cummings School of Medicine, University of Calgary, 3330 Hospital Dr. NW, Calgary, AB, T2N 4B1, Canada

    D. L. Church

  3. Calgary Laboratory Services (Now Alberta Precision Laboratories), 9-3535 Research Rd NW, Calgary, AB, T2L 2K8, Canada

    B. Chow, M. Groeschel, J. Carson, T. Griener & D. L. Church

Authors
  1. B. Chow
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. M. Groeschel
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. J. Carson
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. T. Griener
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. D. L. Church
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

BC, TG and DLC developed the study design, execution, oversight, data analysis and were the lead writers of the manuscript. MG and DLC performed retrospective clinical review and data analysis and MG reviewed and edited the manuscript. JC provided laboratory bench testing oversight and reviewed and edited the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to D. L. Church.

Ethics declarations

Ethics approval and consent to participate

The study was approved, and a waiver of informed consent was granted by the Conjoint Health Ethics Research Board (CHREB), Alberta Health Services, and the University of Calgary (Ethics ID: E-23969). All methods were carried out in accordance with relevant guidelines and regulations.

Consent for publication

Not applicable.

Competing interests

None of the authors have a conflict of interest.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Chow, B., Groeschel, M., Carson, J. et al. Development and evaluation of a novel fast broad-range PCR and sequencing assay (FBR-PCR/S) using dual priming oligonucleotides targeting the ITS/LSU gene regions for rapid diagnosis of invasive fungal diseases: multi-year experience in a large Canadian healthcare zone. BMC Infect Dis 22, 375 (2022). https://doi.org/10.1186/s12879-022-07356-9

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12879-022-07356-9

Keywords

BMC Infectious Diseases

ISSN: 1471-2334

Contact us