Skip to main content
Download PDF

Clonal diversity and genomic characterization of Panton-valentine Leukocidin (PVL)-positive Staphylococcus aureus in Tehran, Iran

BMC Infectious Diseases volume 21, Article number: 372 (2021) Cite this article

Abstract

Background

Some Staphylococcus aureus strains produce Panton-Valentine leukocidin (PVL), a bi-component pore-forming toxin, which causes leukocyte lysis and tissue necrosis. Currently, there is very limited information on the molecular epidemiology of PVL-encoding S. aureus strains in Iran. This study aimed to determine the molecular epidemiology and genetic background of PVL-positive S. aureus clinical strains isolated from Iranian patients.

Methods

A total of 28 PVL-positive S. aureus strains were detected from 600 S. aureus isolates between February 2015 and March 2018 from different hospitals in Tehran, Iran. Antimicrobial susceptibility testing was performed according to the Clinical and Laboratory Standards Institute (CLSI) guidelines. Molecular genotyping was performed using SCCmec and accessory gene regulator (agr) typing, PVL haplotyping, multilocus sequence typing (MLST), and pulsed-field gel electrophoresis (PFGE).

Results

The highest antibiotic resistance rate was found to be against erythromycin (57.1%), followed by ciprofloxacin (42.8%) and clindamycin (35.7%). Moreover, 19 (67.9%) out of 28 S. aureus isolates were identified as MRSA, including CA-MRSA (14/19, 73.7%) and HA-MRSA (5/19, 26.3%). SCCmec type IVa was detected as the predominant type (10/19, 52.6%), followed by type III (5/19, 26.3%) and type V (4/19, 21.1%). The agr type I was identified as the most common type (14/28, 50%), and H and R haplotype groups were observed at frequencies of 67.9 and 32.1%, respectively. Among H variants, the predominant variant was H2 (78/9%). The isolates encompassed 21 different sequence types (STs), including 16 new STs (ST5147 to ST5162). Based on eBURST analysis, the isolates were clustered into five CCs, including CC30, CC22, CC1, CC8, and CC5 (ST5160), and nine singletons. PFGE typing showed that 24 isolates were clustered into A (4 pulsotypes), B (9 pulsotypes), and C (11 pulsotypes) clusters.

Conclusions

A high prevalence of PVL-positive CA-MRSA strains was detected in Iran. The majority of PVL-positive isolates were of H (mostly H2) variant, while R variant was harbored by 100% of PVL-positive MRSA strains. Also, CC8, CC22, and CC30 were identified as the dominant clones among PVL-encoding S. aureus strains. This study promotes a better understanding of the molecular epidemiology and evolution of PVL-positive S. aureus strains in Iran.

Peer Review reports

Background

Staphylococcus aureus (S. aureus)-associated disorders vary from skin infections to life-threatening invasive diseases, such as bacteremia, sepsis, and endocarditis, mediated by a variety of virulence factors [1, 2]. S. aureus plays an important role in the development of epidural abscesses, meningitis, toxic shock syndrome (TSS), urinary tract infections (UTIs), septic thrombophlebitis, pneumonia, etc. [3, 4]. S. aureus causes invasive infections in all age groups, but the prevalence of these infections is somewhat higher in infants and patients over 65 years of age [3]. Panton-Valentine Leukocidin (PVL) is a two-component toxin produced by some S. aureus strains in varying amounts [5, 6]. However, the majority of isolates that cause skin and soft tissue infections (SSTI) and severe necrotizing pneumonia are PVL-positive [7]. This preforming toxin is encoded by a 1.9-kb lukSF-PV locus consisting of two contiguous, but co-transcribed lukF and lukS genes [8]. It is well documented that these two components are secreted by S. aureus strains, and before they assemble into a pore-forming heptamer on neutrophil membranes, they could induce lysis of host defense cells, including human polymorphonuclear neutrophils (PMNs), monocytes, and macrophages [9, 10]. PVL causes apoptosis in neutrophils through the activation of caspase-3 and -9; the participation of TLR2 (toll like receptor 2) in causing inflammation by PVL in the lung has also been reported [4].

Generally, phages are considered as one of the major mobile genetic elements (MGEs) among S. aureus strains, which are strongly able to transfer antibiotic resistance markers and virulence attributes [11, 12]. The genes encoding PVL are also located on lysogenized bacteriophages integrated into the chromosomal content of S. aureus [9]. Currently, these phages are classified into the order Caudovirales, which could be divided into three major families based on the tail morphology, including Podoviridae, Siphoviridae, and Myoviridae [8]. To date, at least 10 PVL phages belonging to the Siphoviridae family have been identified and sequenced, including 108PVL, PVL, tp310–1, SLT, Sa2958, Sa2MW, Sa2usa, 7247PVL/ST5967PVL, TCH60, and Sa119 PVL [13,14,15,16,17]. They are characterized as double-stranded, non-enveloped DNA viruses with an icosahedral head and a long non-contractile tail [5, 12].

The emergence of PVL-positive methicillin-resistant S. aureus (PVL-MRSA) isolates have been reported worldwide [18]. Previous studies have revealed a strongassociation between the presence of PVL genes and community-associated MRSA (CA-MRSA) strains, especially those carrying staphylococcal cassette chromosomemec (SCCmec) types IV [19]. Moreover, hospital-acquired MRSA (HA-MRSA) strains that carry PVL genes have been reported in various geographical regions inEurope and Asia [9, 19, 20]. Generally, infections caused by PVL-positive methicillin-sensitive S. aureus (PVL-MSSA) strains have been reported to play the role ofreservoirs for PVL-MRSA due to clonality and evolutionary relationships [21].

Some studies have shown an association between PVL genes and invasive diseases, implying that PVL is an epidemiological marker for severe infection syndrome; also, individuals with PVL-positive skin and soft-tissue infections are more likely to require surgery compared to those with PVL-negative infection. In some countries, this notion has led to the implementation of public health measures for individuals infected with PVL-producing strains. Compared with PVL-negative S. aureus, PVL-positive S. aureus strains are more likely to be truly community-acquired, infecting individuals who have not had contact with healthcare settings [10]. However, the potential risk of spreading PVL-positive S. aureus strains to hospitals is considered as a significant public health concern, as the establishment of a PVL-positive clonal lineage of HA-MRSA strains could rapidly lead to dramatically worse outcomes for HA-MRSA patients. However, there are clonal lineages from which HA-MRSA and CA-MRSA have been reported [5].

To date, at least 22 single-nucleotide polymorphisms (SNPs) have been identified in the lukSF-PV genes based on phylogenetic analysis [8, 13, 22]. Additionally, a number of non-synonymous mutations have been detected in different isoforms of PVL protein. PVL-positive S. aureus strains could be classified into four major haplotype groups (R, H1, H2, H3) based on non-synonymous variations in the PVL sequence at nucleotide positions 527, 663, and 1396 [22, 23].

The population structure and clones of MRSA strains are changing in different healthcare facilities in different countries. The most prevalent PVL-MRSA types in the United States belong to ST8 (USA300), ST1 (USA400), ST59 (USA1000), and ST30 (USA1100), while ST80 clone is commonly reported in European countries [24]. Furthermore, several clones belonging to ST80, ST30, ST59, and ST22 have been reported as the most frequent clones in Asia [24,25,26]. Previous studies in Iran have reported ST22, ST30, ST8, ST931, ST722, ST15, ST88, ST239, ST291, and ST585 as the predominant clones among MRSA strains [27,28,29]

Currently, there is very limited data on the molecular epidemiology of PVL-encoding S. aureus clinical strains in Iran. In addition, no details have yet been reported about PVL haplotype groups of S. aureus strains in Iran. The present study aimed to obtain a more complete description about the molecular epidemiology and genetic background of PVL-positive S. aureus clinical strains isolated from Iranian patients using a combination of molecular typing techniques, including SCCmec and accessory gene regulator (agr) typing, PVL haplotyping, multilocus sequence typing (MLST) analysis, and pulsed-field gel electrophoresis (PFGE). The antibiotic susceptibility of the strains was also determined.

Materials and methods

Bacterial strains

In this study 600 S. aureus isolates were analysed and a total of 28 PVL-positive S. aureus strains were collected from February 2015 to March 2018 from different hospitals in Tehran, Iran. The strains were obtained from both outpatients (24 strains) and inpatients (4 strains). Clinical data and demographic information were recorded for all patients enrolled in this study using a questionnaire. All patients or their legal guardians provided their written informed consent. This study was approved by the Medical Ethics Committee of Tarbiat Modares University before it began. In addition, all methods were carried out in accordance with relevant guidelines and regulations at Tarbiat Modares University.

All S. aureus strains were identified using conventional phenotypic and biochemical examinations, including colony morphology, Gram staining, mannitol fermentation on mannitol salt agar (MSA), positive reactions in catalase, slide and tube coagulase, and DNase tests. Isolates were preserved in tryptic soy broth (TSB) with 20% glycerol (v/v) at − 80 °C.

Antimicrobial susceptibility testing

Antimicrobial susceptibility testing was performed by the Kirby-Bauer disk diffusion method according to the Clinical and Laboratory Standards Institute guidelines [31] using the following antibiotics (Mast Diagnostics, UK): chloramphenicol (30 μg), amikacin (30 μg), erythromycin (15 μg), clindamycin (2 μg), gentamicin (10 μg), linezolid (30 μg), ciprofloxacin (5 μg), trimethoprim-sulfamethoxazole (25 μg), rifampicin (5 μg), and cefoxitin (30 μg). S. aureus ATCC 25923 was used for quality control.

Genomic DNA preparation and detection of pvl gene

Genomic DNA was extracted using Gram Positive DNA Purification Kit (Gene Transfer Pishgaman, Iran) according to the manufacturer’s protocol. DNA samples were evaluated in terms of quality by electrophoresis on 0.8% (w/v) agarose gels and then stored at − 20 °C until used for PCR analysis. PCR was used to confirm the presence of pvl gene in all strains using specific primers (pvl-F GGAAACATTTATTCTGGCTATAC and pvl-R CTGGATTGAAGTTACCTCTGG), yielding a 502 bp fragment as previously described [32].

Detection of MRSA strains and SCCmec typing

All S. aureus strains in this study were screened for MRSA according to resistance to cefoxitin (30 μg) using the Kirby-Bauer disk diffusion method ([33]). The identity of MRSA strains was confirmed by detection of mecA using PCR method ([33]). A multiplex PCR-based method was also carried out for SCCmec typing as previously described [32]. The oligonucleotide primers used to amplify the genes of interest are listed in Table 1.

Table 1 Oligonucleotide primers used in this study
Full size table

agr genotyping by multiplex PCR

The agr types (I–IV) were determined by a multiplex PCR assay as described by Shopsin et al. [34]. The oligonucleotide primers used to amplify the genes of interest are listed in Table 1.

Determination of PVL haplotype groups

A PCR-based sequencing method was applied to determine SNPs in the lukSF-PV genes of all S. aureus strains. PCR amplifications were performed using a primer pair (lukS-F GTGGTCCATCAACAGGAGGT and lukF-R TGGTCCCCAACCATTATTCA) specifically designed to generate a 1107 bp fragment (nucleotides 440 to 1546) of the lukSF-PV genes. PCR was carried out in a final volume of 25 μL reaction mixture containing 10 μL of Taq DNA Polymerase Master Mix (Ampliqon, Denmark), 0.5 μL of each primer (10 pmol), and 2 μL of template DNA (approximately 200 ng) using a thermocycler (Eppendorf, Hamburg, Germany). Amplifications were run under the following cycling conditions: an initial denaturation at 94 °C for 5 min; followed by 30 cycles of denaturation at 94 °C for 1 min, 57 °C for 1 min, and 72 °C for 1 min; and a final elongation step at 72 °C for 5 min. Sanger sequencing of both strands was performed using an automated sequencer (Microsynth, Balgach, Switzerland). DNA sequences were edited by Chromas Lite software Version 2.5.1 (Technelysium Pty Ltd., Australia). The edited nucleotide sequences of LukSF-PV genes were subjected to in-frame translation using BioEdit software Version 7.2.5 and aligned to the sequence of MRSA strain USA300 (GenBank: CP000255.1) as a reference sequence.

MLST

MLST was performed for all S. aureus strains using previously reported primers specific for seven housekeeping genes, including arcC, aroE, glpF, gmk, pta, tpi, and yqiL, according to the previously described protocol [35]. The sequences of the PCR products were compared to those of the existing alleles available on the MLST website (https://pubmlst.org/saureus/) and analyzed online to assign allelic profile (sequence type, ST) and the associated clonal complex (CC). The minimum spanning tree (MST) was constructed by the goeBURST algorithm using PHYLOViZ 2.0 software (https://www.phyloviz.net/).

PFGE

PFGE was performed using SmaI restriction enzyme (Takara, Japan) digestion according to the protocol described by the Center for Disease Control and Prevention (CDC) with minor modifications (https://www.cdc.gov/pulsenet/pathogens/pfge.html). The chromosomal DNA of Salmonella enterica serovar Braenderup (H9182) was used as the normalization standard and molecular marker. Digested plugs were loaded into the wells of a 1% agarose gel and run in 0.5X TBE using a CHEF (contour-clamped homogeneous electric field)-DR III system (Bio-Rad, Hercules, CA). After completing the electrophoresis process, the gel was stained using a 1.5 μg/mL ethidium bromide solution for 30–40 min on a rocking shaker in a covered container. Destaining was done three times with distilled water on the shaker for 45 min, and then the gel was visualized and photographed. Gel photos were processed and analyzed using GelCompare II software V. 4.0 (Applied Maths, Saint Martens-Latem, Belgium). Similarities between electrophoretic patterns were calculated using the Dice coefficient and set to 80% to determine the pulsed-field type clusters after reviewing the epidemiologic data associated with each of the clusters of isolates. The unweighted pair group method with arithmetic means (UPGMA) was used to construct a dendrogram with 1.5% tolerance and optimization as standard settings.

Results

Antibiotic resistance profiles

The antibiotic resistance profiles of 28 PVL-positive S. aureus isolates against various antibiotics are shown in Fig. 1. The highest resistance was observed against erythromycin (16/28, 57.1%), followed by ciprofloxacin (12/28, 42.8%), clindamycin (10/28, 35.7%), rifampicin (9/28, 32.1%), gentamicin (5/28, 17.8%), amikacin (4/28, 14.3%), and trimethoprim-sulfamethoxazole (3/28, 10.7%). The lowest resistance was observed against linezolid and chloramphenicol with the same rate (1/28, 3.6%). Of 28 PVL-positive S. aureus isolates, 19 (67.9%) isolates were MRSA, including CA-MRSA (14/19, 73.7%) and HA-MRSA (5/19, 26.3%). Among MRSA isolates, the highest resistance was observed against erythromycin (10/19, 52.6%) and ciprofloxacin (8/19, 42.1%). All MRSA isolates were susceptible to linezolid, and resistance to trimethoprim-sulfamethoxazole and chloramphenicol was observed in 10.5 and 5.3% of the isolates, respectively. Of 19 MRSA isolates, 5 (26.3%) were found to be resistant to at least three tested antibiotics. Among MSSA (9/28, 32.1%) isolates, the highest resistance rate was observed against erythromycin and clindamycin (6/9, 66.7%). All MSSA isolates were found to be susceptible to chloramphenicol and amikacin.

Fig. 1
figure 1

Bar graph presenting antimicrobial susceptibility patterns of 28 PVL-positive S. aureus isolates in this study

Full size image

SCCmec and agr typing

By SCCmec typing, only three types (types III, IVa, and V) were found among 19 PVL-positive MRSA isolates. The most common type of SCCmec was type IVa (10/19, 52.6%), followed by type III (5/19, 26.3%) and type V (4/19, 21.1%).

The agr types of all 28 PVL-positive S. aureus isolates (MSSA and MRSA) indicated that agr type I was the predominant one (14/28, 50%), followed by type III (10/28, 35.8%), type II (3/28, 10.7%), and type IV (1/28, 3.5%). The detailed antibiotic resistance profile and molecular characterization of PVL-positive isolates by SCCmec, agr, haplotype, MLST, and PFGE typing are shown in Table 2.

Table 2 The detailed antibiotic resistance profile and molecular characterization of 28 PVL-positive S. aureus isolates by haplotype, agr, SCCmec, MLST and PFGE typing
Full size table

Haplotype groups

Approximately 1107 bp fragments of lukSF-PV genes of 28 PVL-positive S. aureus isolates were amplified by PCR, and the products were sequenced. As expected, the sequences were highly conserved, but nucleotide variations were observed at seven sites (positions 470, 527, and 663 located in the lukS locus and positions 1304, 1318, 1393, and 1396 located in the lukF locus) using the lukSF-PV genes of MRSA strain USA300 as a reference. Among the isolates, 19 (67.9%) isolates were of H variant, representing the most common types as defined by O’Hara et al. [22], and the remaining nine (32.1%) isolates were identified as R variant, displaying non-synonymous mutation at nucleotide 527 A to G. Also, H variants were further classified into H1 (4/28, 14.3%) and H2 (15/28, 53.6%) groups which differed in nucleotide position 1396. Furthermore, H1 variants were further divided into H1a (n = 3) and H1b (n = 1) groups according to the differences in nucleotide sites 1304 and 1318. Additionally, H2 variants were grouped into H2a (n = 14) and H2b (n = 1) groups according to the difference in nucleotide site 470. The schematic structure of the lukSF-PV sequence variants found in 28 PVL-positive S. aureus clinical strains under study compared to the lukSF-PV sequence of USA300 strain is shown in Fig. 2. All R variants were MRSA, but only 50% of H1 variants were MRSA. Both R and H1 variants were isolated from the wound and hospitalized patients, except for one case in each variant. H2 variants were isolated from wound, blood and tracheal cultures and 53.3% were MRSA.

Fig. 2
figure 2

Schematic structure of the lukSF-PV sequence variants detected among 28 PVL-positive S. aureus strains in this study compared to the lukSF-PV sequence of USA300 as the reference strain. Red horizontal line indicates the lukSF-PV sequence of USA300 strain. Short vertical lines on the colored lines indicate the positions of sites at which the haplotype differs from that of USA300. Numbers to the left of the horizontal lines indicate the frequency with which the haplotype (R, H1, and H2) was observed. At right, the haplotypes are bracketed according to how they are grouped into haplotype groups

Full size image

MLST

The evolutionary and genetic diversity of 28 PVL-positive S. aureus isolates was analyzed by MLST (Table 2). In this study, 21 distinct STs were identified among the isolates, of which 16 STs did not have matching profiles in the MLST database and were subsequently designated to ST5147-ST5162 after submitting the data to the website (https://pubmlst.org/saureus/). Among the obtained STs, the most frequently identified one was ST30 (6/28, 21.4%), followed by ST1996 and ST1136, each accounted for two isolates (2/28, 7.1%). Other STs accounted for one isolate. ST30 was the predominant type (6/19, 31.6%) among MRSA isolates, while no predominant ST was found among MSSA isolates.

Based on eBURST analysis and by using all S. aureus STs available in the MLST database, the isolates were clustered into five CCs, including CC30 (ST30, ST5148), CC22 (ST22, ST5152, ST5153, ST5155, ST5157), CC1 (ST1136, ST5149), CC8 (ST5148, ST5156, ST5158), and CC5 (ST5160), and nine singletons (ST121, ST1996, ST5151, ST5152, ST5154, ST5159, ST5161, ST5162). The largest cluster was CC30 with seven isolates (25%), followed by CC22 with five isolates (17.9%) as well as CC1 and CC8, each with three isolates (10.7%). The remaining CC5 included one isolate. Among MRSA isolates, the predominant cluster was CC30 including 31.6% (6/19) of the isolates, while no predominant CC was detected among MSSA isolates. Figures 3 and 4 represent the MLST of 576 S. aureus clones downloaded from the MLST website (105 STs) and 443 STs previously described in the literature [27,28,29,30, 36,37,38,39,40,41,42], as well as 28 STs identified in this study, respectively.

Fig. 3
figure 3

The minimum spanning tree (MST) of 28 S. aureus strains was constructed by the goeBURST algorithm using the PHYLOViZ 2.0 software (https://www.phyloviz.net/). Each circle represents a unique sequence type (ST). The size of each circle is proportional to the numbers of isolates per ST. The circles are color-coded according the clonal complex (CC) and singletons. The length between two nodes reflects the genetic distance between the two bordering STs. Similar CCs have color-coded in the legend

Full size image
Fig. 4
figure 4

The minimum spanning tree (MST) of 576 Iranian S. aureus strains was constructed by the goeBURST algorithm using the PHYLOViZ 2.0 software (https://www.phyloviz.net/). The allelic profiles were downloaded from the MLST website (https://pubmlst.org/saureus/) (105 STs) and previously described in the literature (443 STs), which included the sequence types (STs), clonal complexes (CCs) and singletons as well as 28 STs in this study. Each circle represents a unique ST. The size of each circle is proportional to the numbers of isolates per ST. The circles are color-coded according the CCs and singletons. The length between two nodes reflects the genetic distance between the two bordering STs. Similar CCs have color-coded in the legend

Full size image

PFGE

The genetic relationship between 28 PVL-positive S. aureus isolates was determined by PFGE. PFGE typing showed that 24 isolates were clustered into three PFGE clusters (A, B, and C), and the remaining four isolates did not represent satisfactory results for typing. Most of the isolates were divided into PFGE cluster B (9 pulsotypes) and cluster C (11 pulsotypes), together accounting for 62.5% (15/24) of the isolates. The majority of MRSA isolates (10/15, 66.7%) and also R variants (8/9, 88.9%) were grouped in PFGE cluster C. Additionally, most of the H2 variants (7/12, 58.3%) were grouped in PFGE cluster B. Dendrogram depicting the PFGE patterns and characteristics related to genetic background of 24 PVL-positive S. aureus isolates is shown in Fig. 5.

Fig. 5
figure 5

Dendrogram derived from UPGMA cluster analysis of the PFGE patterns and characteristics related to the genetic background of 24 PVL-positive S. aureus isolates. Isolates showing a similarity coefficient ≥ 65% were considered genetically related

Full size image

Discussion

MALDI-TOF MS-based DOT-MGA is also able to perform antimicrobial susceptibility testing within few hours, through specific novel peaks, but is applicable to only some MRSA strains [43]. Therefore, MRSA strains were detected and confirmed by targeting the mecA gene responsible for resistance in staphylococci species, located on mobile genetic element called SCCmec.

Little information is available about the predominant STs, CCs, and particularly haplotype groups of PVL-positive S. aureus strains in Iran. In the current study, attempts were made to raise awareness about the molecular relatedness and epidemiology of PVL-positive S. aureus strains among Iranian patients by applying a number of molecular typing techniques in this setting. In this study, the majority of the isolates (67.85%) were detected to be PVL-positive MRSA. This result is consistent with several previous reports with respect to high prevalence of PVL-positive strains recovered from CA-MRSA [44, 45]. Also, previous studies in Iran have reported a high prevalence of PVL-positive strains among MRSA isolates, ranging from 12 to 60% [27, 28, 40, 42, 46].

Epidemiological studies have revealed that PVL gene is commonly carried by CA-MRSA having SCC mec type IV [47]. The majority of MRSA strains in the current (50%) and previous studies in Iran carried SCCmec IV [30, 34, 36, 38, 41, 46, 48], supporting the hypothesize that SCCmec IV is probably more mobile than other SCCmec types. This hypothesis is further supported by the fact that most public health-associated MRSA infections reported in Iran are caused by casual transmission of CA-MRSA strains. Although PVL gene is more frequently found in CA-MRSA strains, there are some reports of PVL gene recovered from HA-MRSA strains, but with a relatively lower prevalence [31, 37]. In this study, 17.9% of PVL-positive isolates were HA-MRSA. The presence of PVL gene among HA-MRSA strains and the interhospital spread of PVL encoding HA-MRSA strains support the need for system-wide implementation of patient safety and infection control initiatives.

Furthermore, PVL is carried by MSSA strains; thus, they share similar disease potential and epidemiological features with MRSA [49]. Based on most previous reports in Iran, the prevalence of PVL-positive MRSA strains is relatively higher than that of PVL-positive MSSA strains [38, 41, 50], in contrast to some European and UK countries where PVL-encoding MSSA strains are more common than PVL-positive MRSA strains [51, 52]. In agreement with most previous studies in Iran, about one third of the isolates (32.1%) were found to be PVL-positive MSSA in this study [42, 53]. However, in our previous study [54] and the study by Havaei et al. (2017) [55], the prevalence of PVL gene in MSSA strains was higher than in MRSA strains. Therefore, further in-depth studies are required to better understand the probable transfer and mobility of PVL gene among MSSA and MRSA clones.

PVL gene is highly conserved with four major variants (H1, H2, H3, R) identified based on the sequence variations at positions 527, 663, and 1396 [23]. H1 and H2 haplotype groups are more common in India and South Africa, whereas R variants are frequently found in the United States [23]. H variant (particularly the H2 group) has a broader geographical distribution and spreads within several CCs such as CC22, CC30, CC1, CC5, CC8, and CC121 [23, 55]. In this study, 53.6% of the isolates carried H2 variants, which were distributed among five CCs (CC22, CC30, CC1, and CC5). Moreover, 32.1% of R variants were allocated to three CCs including CC22, CC30, and CC8. There is very limited data about haplotype groups of S. aureus strains in Iran. In a recent study by Havaei et al. (2017), 56.6% of S. aureus isolates had H variants, and 43.3% carried R variants [55]. Their study revealed that both R and H variants were detected among S. aureus strains in Iran, consistent with the present study which showed that the mecA gene was present in 52.6% of the strains belonging to H variants. Additionally, some studies have reported that PVL-positive MRSA strains mainly belong to R variants, and only 5% of strains in H variants are mecA-positive [56]. In contrast, this may indicate controversial reports from different geographical locations.

It has been reported that PVL-positive MSSA and MRSA strains belong to diverse clones worldwide [49]. Although different clones were identified in this study, CC30 (31.6%) and CC22 (21%) were the predominant clones and PVL-positive S. aureus strains belonged to five CCs (CC30, CC22, CC8, CC1, CC5). The established four dominant MRSA clones consisted of CC30, CC22, CC1 and CC80. Two and three different SCCmec types were found in CC22 (III, IV) and CC30 (III, IV, V), respectively, and the majority of the strains (60%) in CC22 carried SCCmec type III. Moreover, most PVL-positive CA-MRSA strains belonged to CC30, whereas most PVL-positive HA-MRSA strains belonged to CC22. As previously reported, CC8, CC22, and CC30 are the dominant clones in Iran [28, 30, 42]. PVL-positive MRSA strains belonging to CC30 have been isolated in America, Europe, Asia, and the Southwest Pacific [57,58,59], while PVL-positive MRSA strains belonging to CC22 have been reported in England, Saudi Arabia, Germany, Ireland, Australia, and Nepal [58, 60, 61]. However, both CC22 and CC30 clones have been reported to be predominant in Asian countries [58, 62]. Based on the previous reports and also this study, it could be concluded that the most prevalent CA-MRSA clones in Asian countries including Iran are CC22 and CC30 clones [63, 64]. The predominance of CC22 and CC30 clones among PVL-positive MRSA strains in Iran is of great concern, as these clones appear to be highly transmissible with a propensity to spread worldwide. In the present study, 10.7% of S. aureus strains were related to CC8, and only one of them had SCCmec IV and was assigned to H2 variant. PVL-positive MRSA strains with CC8 and SCCmec IV have been previously reported in Iran [65]. CC8 is one of the most prevalent CCs worldwide and mainly contains nosocomial epidemic MRSA isolates [66]. The highest antibiotic resistance was observed in one PVL-positive HA-MRSA strain belonging to CC8. ST8 SCCmec type IV (USA300 clone) is the predominant clone in the United States but has also been reported in other countries including Anglophone, Pakistan, UK, and some of the Gulf States countries [67]. CC1 was another CC that was detected among PVL-positive strains in this study, accounting for 66.7% of R variant. According to the previous studies results, R variant of PVL is mainly found in CC1, CC8, and CC93 strains [68]. The present study results showed that R variant was harbored by 100% of PVL-positive MRSA strains primarily belonging to CC30, followed by CC1 and CC5, which were different from those CCs (CC8, CC1, and CC93) reported in previous studies [23, 55, 69]. This finding supports the findings of previous studies in Iran, in which CC30, CC22, CC8, and CC1 were detected as the predominant CCs among PVL-positive isolates [29].

In this study, the majority of the isolates (50%) belonged to agr type I. The agr locus belongs to the core variable genome and thus is linked to CCs. The agr typing results were consistent with the findings of previous studies in Iran and China [46, 47, 70]. In the current study, agr I and agr III were detected as the most common types and were linked to CC30, CC22, CC8, and CC1.

PFGE showed a high degree of genetic diversity among PVL-positive S. aureus clones and clustered them into A-C clusters and represented 24 PFGE pulsotypes. All R variants of PVL-positive MRSA strains belonged to cluster C, but H2 variants of these strains were distributed in all three clusters, supporting the hypothesis that H2 groups may display higher genetic diversity than other haplotype groups. This considerable diversity in PVL-positive MRSA strains could be explained by the possibility of isolating MRSA from different sources. Application of genotyping methods such as PFGE may provide a better interpretation of MRSA transmission sources and also help adopt well-intended infection prevention and control measures.

Conclusion

To the best of our knowledge, this is the first comprehensive study investigating the molecular epidemiology and characteristics of PVL-encoding S. aureus clinical strains in Iran using several typing methods. The findings revealed i) a high prevalence of PVL-positive MRSA strains in Iran, ii) the majority of MRSA strains in the current study carried SCCmec IV, iii) both R and H variants were detected among S. aureus strains in Iran, iv) the mecA gene was present in 52.6% of the strains with H variants, v) CC8, CC22, and CC30 were found as the dominant clones among PVL-encoding S. aureus strains, vi) agr I and agr III were detected as the most common types and were linked to CC30, CC22, CC8, and CC1. The most important limitation of the present work was the relatively small sample size, because of low prevalence of MRSA strains. Taken together, the present study results may contribute to the understanding of the molecular epidemiology and evolution of PVL-positive S. aureus in Iran.

Availability of data and materials

The partial nucleotide sequences of LukSF-PV genes of 28 strains generated and/or analyzed during the current study are available in the GenBank/NCBI database (https://www.ncbi.nlm.nih.gov/genbank) under the following accession numbers: MT468493-MT468548.

References

  1. Bien J, Sokolova O, Bozko P. Characterization of virulence factors of Staphylococcus aureus: novel function of known virulence factors that are implicated in activation of airway epithelial proinflammatory response. J Pathog. 2011:1–13. https://doi.org/10.4061/2011/601905.

  2. Turner NA, Sharma-Kuinkel BK, Maskarinec SA, Eichenberger EM, Shah PP, Carugati M, Holland TL, Fowler Jr VG Methicillin-resistant Staphylococcus aureus: an overview of basic and clinical research. Nat Rev Microbiol 2019;17(4):203–218. PubMed PMID: 30737488. Pubmed Central PMCID: PMC6939889. Epub 2019/02/10. eng, DOI: https://doi.org/10.1038/s41579-018-0147-4.

  3. Gajdács M. The continuing threat of methicillin-resistant Staphylococcus aureus. Antibiotics. 2019;8(2):52. https://doi.org/10.3390/antibiotics8020052.

    Article  CAS  PubMed Central  Google Scholar 

  4. Yoong P, Pier GB. Immune-activating properties of Panton-valentine leukocidin improve the outcome in a model of methicillin-resistant Staphylococcus aureus pneumonia. Infect Immun. 2012;80(8):2894–904. https://doi.org/10.1128/IAI.06360-11.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Darboe S, Dobreniecki S, Jarju S, Jallow M, Mohammed NI, Wathuo M, et al. Prevalence of Panton-valentine leukocidin (PVL) and antimicrobial resistance in community-acquired clinical Staphylococcus aureus in an urban Gambian hospital: a 11-year period retrospective pilot study. Front Cell Infect Microbiol. 2019;9:170. https://doi.org/10.3389/fcimb.2019.00170.

  6. Tajik S, Najar-Peerayeh S, Bakhshi B. Hospital clones of Panton-Valentine leukocidin positive and methicillin-resistant Staphylococcus aureus are circulating in the community of Tehran. Journal of Global Antimicrobial Resistance. 2019.

  7. Shallcross LJ, Williams K, Hopkins S, Aldridge RW, Johnson AM, Hayward AC. Panton-valentine leukocidin associated staphylococcal disease: a cross-sectional study at a London hospital, England. Clin Microbiol Infect 2010; 16(11):1644–1648. PubMed PMID: 20969671. Epub 2010/10/26. eng, DOI: https://doi.org/10.1111/j.1469-0691.2010.03153.x.

  8. Zhao H, Hu F, Jin S, Xu X, Zou Y, Ding B, et al. Typing of Panton-valentine leukocidin-encoding phages and lukSF-PV gene sequence variation in Staphylococcus aureus from China. Front Microbiol. 2016;7:1200.

    PubMed  PubMed Central  Google Scholar 

  9. Alonzo F III, Torres VJ. Bacterial survival amidst an immune onslaught: the contribution of the Staphylococcus aureus Leukotoxins. PLoS Pathog. 2013;9(2):e1003143. https://doi.org/10.1371/journal.ppat.1003143.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Shallcross LJ, Fragaszy E, Johnson AM, Hayward AC. The role of the Panton-valentine leucocidin toxin in staphylococcal disease: a systematic review and meta-analysis. Lancet Infect Dis. 2013;13(1):43–54. https://doi.org/10.1016/S1473-3099(12)70238-4.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Moon BY, Park JY, Hwang SY, Robinson DA, Thomas JC, Fitzgerald JR, et al. Phage-mediated horizontal transfer of a Staphylococcus aureus virulence-associated genomic island. Sci Rep. 2015 2015/04/20; 5(1): 9784.

  12. Xia G, Wolz C. Phages of Staphylococcus aureus and their impact on host evolution. Infect Genet Evol 2014 Jan;21:593–601. PubMed PMID: 23660485. Epub 2013/05/11. eng, DOI: https://doi.org/10.1016/j.meegid.2013.04.022.

  13. Boakes E, Kearns A, Ganner M, Perry C, Hill R, Ellington M. Distinct bacteriophages encoding Panton-valentine leukocidin (PVL) among international methicillin-resistant Staphylococcus aureus clones harboring PVL. J Clin Microbiol. 2011;49(2):684–92. https://doi.org/10.1128/JCM.01917-10.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Narita S, Kaneko J, Chiba J-I, Piémont Y, Jarraud S, Etienne J, et al. phage conversion of Panton-valentine leukocidin in Staphylococcus aureus: molecular analysis of a PVL-converting phage, φSLT. Gene. 2001;268(1–2):195–206. https://doi.org/10.1016/S0378-1119(01)00390-0.

    Article  CAS  PubMed  Google Scholar 

  15. Kaneko J, Kimura T, Narita S, Tomita T, Kamio Y. Complete nucleotide sequence and molecular characterization of the temperate staphylococcal bacteriophage φPVL carrying Panton–valentine leukocidin genes. Gene. 1998;215(1):57–67. https://doi.org/10.1016/S0378-1119(98)00278-9.

    Article  CAS  PubMed  Google Scholar 

  16. Kaneko J, Kimura T, Kawakami Y, Tomita T, Kamio Y. Panton-valentine leukocidin genes in a phage-like particle isolated from mitomycin C-treated Staphylococcus aureus V8 (ATCC 49775). Biosci Biotechnol Biochem. 1997;61(11):1960–2. https://doi.org/10.1271/bbb.61.1960.

    Article  CAS  PubMed  Google Scholar 

  17. Zhang M, Ito T, Li S, Jin J, Takeuchi F, Lauderdale TL, et al. Identification of the third type of PVL phage in ST59 methicillin-resistant Staphylococcus aureus (MRSA) strains. FEMS Microbiol Lett 2011; 323(1):20–28. PubMed PMID: 21732964. Epub 2011/07/08. eng, DOI: https://doi.org/10.1111/j.1574-6968.2011.02355.x.

  18. Enany S, Yaoita E, Yoshida Y, Enany M, Yamamoto T. Molecular characterization of Panton-valentine leukocidin-positive community-acquired methicillin-resistant Staphylococcus aureus isolates in Egypt. Microbiol Res. 2010;165(2):152–62. https://doi.org/10.1016/j.micres.2009.03.005.

    Article  CAS  PubMed  Google Scholar 

  19. Nicole A, Lutz J, Peter S, Ralf E, Stefan M, Paul J. Planet. Clonal Replacement of Epidemic Methicillin-Resistant Staphylococcus aureus Strains in a German University Hospital over a Period of Eleven Years. PLoS ONE. 2011;6(11):e28189.

  20. Boswihi SS, Udo EE, Monecke S, Mathew B, Noronha B, Verghese T, et al. Emerging variants of methicillin-resistant Staphylococcus aureus genotypes in Kuwait hospitals. PLOS ONE. 2018;13(4):e0195933.

  21. Otokunefor K, Sloan T, Kearns AM, James R. Molecular characterization and Panton-valentine leucocidin typing of community-acquired methicillin-sensitive Staphylococcus aureus clinical isolates. J Clin Microbiol. 2012;50(9):3069–72. https://doi.org/10.1128/JCM.00602-12.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Chen L, Chavda KD, Solanki M, Mediavilla JR, Mathema B, Schlievert PM, et al. Genetic variation among Panton-valentine leukocidin-encoding bacteriophages in Staphylococcus aureus clonal complex 30 strains. J Clin Microbiol. 2013;51(3):914–9. https://doi.org/10.1128/JCM.03015-12.

  23. O'Hara FP, Guex N, Word JM, Miller LA, Becker JA, Walsh SL, et al. A geographic variant of the Staphylococcus aureus Panton-valentine leukocidin toxin and the origin of community-associated methicillin-resistant S. aureus USA300. J Infect Dis. 2008;197(2):187–94. https://doi.org/10.1086/524684.

    Article  CAS  PubMed  Google Scholar 

  24. Tristan A, Bes M, Meugnier H, Lina G, Bozdogan B, Courvalin P, et al. Global distribution of Panton-valentine leukocidin–positive methicillin-resistant Staphylococcus aureus, 2006. Emerg Infect Dis. 2007;13(4):594–600. https://doi.org/10.3201/eide1304.061316.

  25. Xiao N, Yang J, Duan N, Lu B, Wang L. Community-associated Staphylococcus aureus PVL+ ST22 predominates in skin and soft tissue infections in Beijing, China. Infect Drug Resist. 2019;12:2495–503. https://doi.org/10.2147/IDR.S212358.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Wang X, Liu Q, Zhang H, Li X, Huang W, Fu Q, et al. Molecular characteristics of community-associated Staphylococcus aureus isolates from pediatric patients with bloodstream infections between 2012 and 2017 in Shanghai, China. Front Microbiol. 2018;9:1211. https://doi.org/10.3389/fmicb.2018.01211.

  27. Goudarzi M, Bahramian M, Tabrizi MS, Udo EE, Figueiredo AMS, Fazeli M, et al. Genetic diversity of methicillin resistant Staphylococcus aureus strains isolated from burn patients in Iran: ST239-SCCmec III/t037 emerges as the major clone. Microb Pathog. 2017;105:1–7. https://doi.org/10.1016/j.micpath.2017.02.004.

    Article  CAS  PubMed  Google Scholar 

  28. Mirzaee M, Najar-Peerayeh S, Behmanesh M, Moghadam MF. Relationship between adhesin genes and biofilm formation in vancomycin-intermediate Staphylococcus aureus clinical isolates. Curr Microbiol. 2015;70(5):665–70. https://doi.org/10.1007/s00284-014-0771-9.

    Article  CAS  PubMed  Google Scholar 

  29. Goudarzi M, Navidinia M, Beiranvand E, Goudarzi H. Phenotypic and molecular characterization of methicillin-resistant Staphylococcus aureus clones carrying the Panton-valentine leukocidin genes disseminating in Iranian hospitals. Microb Drug Resist. 2018;24(10):1543–51. https://doi.org/10.1089/mdr.2018.0033.

    Article  CAS  PubMed  Google Scholar 

  30. Solmaz Ohadian Moghadam, Mohammad Reza Pourmand, Mahmood Mahmoudi, Hooman Sadighian. Molecular characterization of methicillinresistant Staphylococcus aureus: characterization of major clones and emergence of epidemic clones of sequence type (ST) 36 and ST 121 in Tehran, Iran. FEMS Microbiology Letters 2015;362(8):fnv043.

  31. Clinical ILPsfastoab. informational supplement: Clinical and Laboratory Standards Institute (CLSI). 2019.

  32. Azimian A, Havaei SA, Fazeli H, Naderi M, Ghazvini K, Samiee SM, et al. Genetic characterization of a vancomycin-resistant Staphylococcus aureus isolated from respiratory tract of a hospitalized patient in a university hospital in north east of Iran. J Clin Microbiol. 2012:JCM. 01727–01712.

  33. Tajik S, Najar-Peerayeh S, Bakhshi B, Golmohammadi R. Molecular characterization of community-associated methicillin-resistant Staphylococcus aureus in Iranian burn patients. Iran J Pathol. 2019;14(4):284–9. https://doi.org/10.30699/IJP.2019.94189.1917.

    Article  PubMed  PubMed Central  Google Scholar 

  34. Shopsin B, Mathema B, Alcabes P, Said-Salim B, Lina G, Matsuka A, et al. Prevalence of agr specificity groups among Staphylococcus aureus strains colonizing children and their guardians. J Clin Microbiol. 2003;41(1):456–9. https://doi.org/10.1128/JCM.41.1.456-459.2003.

  35. Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones ofStaphylococcus aureus. J Clin Microbiol. 2000;38(3):1008–15. https://doi.org/10.1128/JCM.38.3.1008-1015.2000.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Goudarzi M, Goudarzi H, Figueiredo AMS, Udo EE, Fazeli M, Asadzadeh M, et al. Molecular characterization of methicillin resistant Staphylococcus aureus strains isolated from intensive care units in Iran: ST22-SCCmec IV/t790 emerges as the major clone. PLoS One. 2016;11(5):e0155529. https://doi.org/10.1371/journal.pone.0155529.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Besharati R, Ghafouri M, Safamanesh S, Khosrojerdi M, Ghazvini K, Nojumi S, et al. Molecular epidemiology of panton-valentine leukocidin harboring hospital-associated methicillin-resistant Staphylococcus aureus in septicemic children, Northeastern Iran, Bojnurd. Jundishapur J Microbiol. 2019;12(2).e68183.

  38. Japoni-Nejad A, Rezazadeh M, Kazemian H, Fardmousavi N, van Belkum A, Ghaznavi-Rad E. Molecular characterization of the first community-acquired methicillin-resistant Staphylococcus aureus strains from Central Iran. Int J Infect Dis. 2013;17(11):e949–e54. https://doi.org/10.1016/j.ijid.2013.03.023.

    Article  CAS  PubMed  Google Scholar 

  39. Ziasistani M, Shakibaie MR, Kalantar-Neyestanaki D. Genetic characterization of two vancomycin-resistant Staphylococcus aureus isolates in Kerman, Iran. Infect Drug Resist. 2019;12:1869–75. https://doi.org/10.2147/IDR.S205596.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Sobhanipoor MH, Ahmadrajabi R, Karmostaji A, Saffari F. Molecular characterization of nasal methicillin resistant Staphylococcus aureus isolates from workers of an automaker company in Southeast Iran. Apmis. 2017;125(10):921–6. https://doi.org/10.1111/apm.12732.

    Article  CAS  PubMed  Google Scholar 

  41. Havaei SA, Azimian A, Fazeli H, Naderi M, Ghazvini K, Samiee SM, et al. Isolation of Asian endemic and livestock associated clones of methicillin resistant Staphylococcus aureus from ocular samples in northeastern Iran. Iran J Microbiol. 2013;5(3):227–32.

  42. Havaei SA, Vidovic S, Tahmineh N, Mohammad K, Mohsen K, Starnino S, et al. Epidemic methicillin-susceptible Staphylococcus aureus lineages are the main cause of infections at an Iranian university hospital. J Clin Microbiol. 2011;49(11):3990–3. https://doi.org/10.1128/JCM.05445-11.

  43. Nix ID, Idelevich EA, Storck LM, Sparbier K, Drews O, Kostrzewa M, et al. Detection of methicillin resistance in Staphylococcus aureus from agar cultures and directly from positive blood cultures using MALDI-TOF mass spectrometry-based direct-on-target microdroplet growth assay. Front Microbiol. 2020;11:232. https://doi.org/10.3389/fmicb.2020.00232.

  44. Quadri SA, Al-Sultan AA, Al-Ramdan AM, Badger-Emeka LI, Ali SI. Frequency of panton–valentine leukocidin gene among clinical isolates of methicillin-resistant staphylococcus aureus in Eastern Province of Saudi Arabia. J Global Infect Dis. 2020;12(1):37–8. https://doi.org/10.4103/jgid.jgid_27_19.

    Article  Google Scholar 

  45. Thabit AG, Ahmed EH, Mohamed AI, Yassin AS, Ibrahim MA, Amin MM. Molecular detection of Panton-valentine Leukocidin (PVL) and methicillin resistance in Staphylococcus aureus pathogen. Egypt J Med Microbiol. 2017;38(5793):1–6.

    Google Scholar 

  46. Zhao C, Liu Y, Zhao M, Liu Y, Yu Y, Chen H, et al. Characterization of community acquired Staphylococcus aureus associated with skin and soft tissue infection in Beijing: high prevalence of PVL+ ST398. PLoS One. 2012;7(6):e38577. https://doi.org/10.1371/journal.pone.0038577.

  47. Ghasemian A, Peerayeh SN, Bakhshi B, Mirzaee M. Detection of accessory gene regulator groups genes and cassette chromosome mec types among Staphylococcus aureus isolated from intensive care unit patients. Asian Pac J Trop Dis. 2015;5(2):153–7. https://doi.org/10.1016/S2222-1808(14)60643-5.

    Article  CAS  Google Scholar 

  48. Gökmen TG, Kalayci Y, Yaman A, Köksal F. Molecular characterization of methicillin-resistant Staphylococcus aureus strains by spa typing and pulsed field gel electrophoresis methods. BMC Microbiol. 2018;18(1):155. https://doi.org/10.1186/s12866-018-1305-6.

    Article  CAS  Google Scholar 

  49. Sanchini A, Del Grosso M, Villa L, Ammendolia MG, Superti F, Monaco M, et al. Typing of Panton-valentine leukocidin-encoding phages carried by methicillin-susceptible and methicillin-resistant Staphylococcus aureus from Italy. Clin Microbiol Infect. 2014;20(11):O840–O6. https://doi.org/10.1111/1469-0691.12679.

    Article  CAS  PubMed  Google Scholar 

  50. Moghadam SO, Yaghooti MM, Pourramezan N, Pourmand MR. Molecular characterization and antimicrobial susceptibility of the CA-MRSA isolated from healthcare workers, Tehran, Iran. Microbial Pathog. 2017;107:409–12. https://doi.org/10.1016/j.micpath.2017.04.027.

    Article  CAS  Google Scholar 

  51. Tinelli M, Monaco M, Vimercati M, Ceraminiello A, Pantosti A. Methicillin-susceptible Staphylococcus aureus in skin and soft tissue infections, Northern Italy. Emerg Infect Dis. 2009;15(2):250–7. https://doi.org/10.3201/eid1502.080010.

    Article  PubMed  PubMed Central  Google Scholar 

  52. Romano-Bertrand S, Filleron A, Mesnage R, Lotthé A, Didelot MN, Burgel L, et al. Staphylococcus aureus in a neonatal care center: methicillin-susceptible strains should be a main concern. Antimicrob Resist Infect Control. 2014;3(1):21. https://doi.org/10.1186/2047-2994-3-21.

  53. Khosravi AD, Hoveizavi H, Farshadzadeh Z. The prevalence of genes encoding leukocidins in Staphylococcus aureus strains resistant and sensitive to methicillin isolated from burn patients in Taleghani hospital, Ahvaz, Iran. Burns. 2012;38(2):247–51. https://doi.org/10.1016/j.burns.2011.08.002.

    Article  PubMed  Google Scholar 

  54. Tajik S, Najar-Peerayeh S, Bakhshi B. Hospital clones of Panton-valentine leukocidin-positive and methicillin-resistant Staphylococcus aureus circulating in the Tehran community. J Glob Antimicrobial Resist. 2020;22:177–81. https://doi.org/10.1016/j.jgar.2019.12.010.

    Article  Google Scholar 

  55. Havaei SA, Poursina F, Ahmadpour M, Havaei SR, Ruzbahani M. Detection of Panton-valentine Leukocidin gene isoforms of Staphylococcus aureus isolates in Al-Zahra Hospital, Isfahan-Iran. Adv Biomed Res. 2017:6.

  56. Dumitrescu O, Tristan A, Meugnier H, Bes M, Gouy M, Etienne J, et al. Polymorphism of the Staphylococcus aureus Panton-valentine leukocidin genes and its possible link with the fitness of community-associated methicillin-resistant S. aureus. J Infect Dis. 2008;198(5):792–4. https://doi.org/10.1086/590914.

  57. Boswihi SS, Udo EE, Al-Sweih N. Shifts in the clonal distribution of methicillin-resistant Staphylococcus aureus in Kuwait hospitals: 1992-2010. PLoS One. 2016;11(9):e0162744. https://doi.org/10.1371/journal.pone.0162744.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  58. Monecke S, Coombs G, Shore AC, Coleman DC, Akpaka P, Borg M, et al. A field guide to pandemic, epidemic and sporadic clones of methicillin-resistant Staphylococcus aureus. PLoS One. 2011;6(4):e17936. https://doi.org/10.1371/journal.pone.0017936.

  59. Andrade-Figueiredo M, Leal-Balbino TC. Clonal diversity and epidemiological characteristics of Staphylococcus aureus: high prevalence of oxacillin-susceptible mecA-positive Staphylococcus aureus (OS-MRSA) associated with clinical isolates in Brazil. BMC Microbiol. 2016;16(1):115. https://doi.org/10.1186/s12866-016-0733-4.

    Article  PubMed  PubMed Central  Google Scholar 

  60. Senok A, Somily A, Raji A, Gawlik D, Al-Shahrani F, Baqi S, et al. Diversity of methicillin-resistant Staphylococcus aureus CC22-MRSA-IV from Saudi Arabia and the Gulf region. Int J Infect Dis. 2016;51:31–5. https://doi.org/10.1016/j.ijid.2016.08.016.

    Article  CAS  PubMed  Google Scholar 

  61. Brown ML, O'Hara FP, Close NM, Mera RM, Miller LA, Suaya JA, et al. Prevalence and sequence variation of Panton-valentine leukocidin in methicillin-resistant and methicillin-susceptible Staphylococcus aureus strains in the United States. J Clin Microbiol. 2012;50(1):86–90. https://doi.org/10.1128/JCM.05564-11.

  62. Song J-H, Hsueh P-R, Chung DR, Ko KS, Kang C-I, Peck KR, et al. Spread of methicillin-resistant Staphylococcus aureus between the community and the hospitals in Asian countries: an ANSORP study. J Antimicrob Chemother. 2011;66(5):1061–9. https://doi.org/10.1093/jac/dkr024.

  63. Goudarzi M, Kobayashi N, Dadashi M, Pantůček R, Nasiri MJ, Fazeli M, et al. Prevalence, genetic diversity, and temporary shifts of inducible clindamycin resistance Staphylococcus aureus clones in Tehran, Iran: a molecular–epidemiological analysis from 2013 to 2018. Front Microbiol. 2020;11. https://doi.org/10.3389/fmicb.2020.00663.

  64. Stefani S, Chung DR, Lindsay JA, Friedrich AW, Kearns AM, Westh H, et al. Meticillin-resistant Staphylococcus aureus (MRSA): global epidemiology and harmonisation of typing methods. Int J Antimicrob Agents. 2012;39(4):273–82. https://doi.org/10.1016/j.ijantimicag.2011.09.030.

  65. Azimian A, Havaei SA, Khosrojerdi M, Naderi M, Samiee S. Isolation of PVL/ACME-positive, community acquired, methicillin-resistant Staphylococcus aureus (USA300) from Iran. J Med Microbiol Infect Dis. 2014;2(3):100–4.

    Google Scholar 

  66. Liu Y, Wang H, Du N, Shen E, Chen H, Niu J, et al. Molecular evidence for spread of two major methicillin-resistant Staphylococcus aureus clones with a unique geographic distribution in Chinese hospitals. Antimicrob Agents Chemother. 2009;53(2):512–8. https://doi.org/10.1128/AAC.00804-08.

    Article  CAS  PubMed  Google Scholar 

  67. Jamil B, Gawlik D, Syed MA, Shah AA, Abbasi SA, Müller E, et al. Hospital-acquired methicillin-resistant Staphylococcus aureus (MRSA) from Pakistan: molecular characterisation by microarray technology. Eur J Clin Microbiol Infect Dis. 2018;37(4):691–700. https://doi.org/10.1007/s10096-017-3161-y.

  68. Zhang C, Guo Y, Chu X. In vitro generation of Panton-valentine leukocidin (PVL) in clinical methicillin-resistant Staphylococcus aureus (MRSA) and its correlation with PVL variant, clonal complex, infection type. Sci Rep. 2018;8(1):1–7.

    Google Scholar 

  69. Tong SY, Lilliebridge RA, Holt DC, Coombs GW, Currie BJ, Giffard PM. Rapid detection of H and R Panton–valentine leukocidin isoforms in Staphylococcus aureus by high-resolution melting analysis. Diagn Microbiol Infect Dis. 2010;67(4):399–401. https://doi.org/10.1016/j.diagmicrobio.2010.03.015.

    Article  CAS  PubMed  Google Scholar 

  70. Azimian A, Najar-Pirayeh S, Mirab-Samiee S, Naderi M. Occurrence of methicillin resistant Staphylococcus aureus (MRSA) among clinical samples in Tehran-Iran and its correlation with polymorphism of specific accessory gene regulator (AGR) groups. Braz J Microbiol. 2012;43(2):779–85. https://doi.org/10.1590/S1517-83822012000200043.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

The current study was supported by Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran.

Funding

This work was supported by the Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran.

Author information

Authors and Affiliations

  1. Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Jalal-Ale-Ahmad Ave, Tehran, 14117-13116, Iran

    Zahra Najafi olya, Shahin Najar-Peerayeh & Bita Bakhshi

  2. Foodborne and Waterborne Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran

    Abbas Yadegar

Authors
  1. Zahra Najafi olya
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Shahin Najar-Peerayeh
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Abbas Yadegar
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Bita Bakhshi
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

ZNO performed the microbiological experiments, molecular tests, and data analysis; SNP contributed to study design, and conceptualization; AY and ZNO wrote the manuscript draft; AY, SNP and BB critically revised the manuscript. All authors approved the final version of the manuscript and authorship.

Corresponding author

Correspondence to Bita Bakhshi.

Ethics declarations

Ethics approval and consent to participate

This study was reviewed and approved by the Medical Ethics Committee of Tarbiat Modares University, Tehran, Iran.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Najafi olya, Z., Najar-Peerayeh, S., Yadegar, A. et al. Clonal diversity and genomic characterization of Panton-valentine Leukocidin (PVL)-positive Staphylococcus aureus in Tehran, Iran. BMC Infect Dis 21, 372 (2021). https://doi.org/10.1186/s12879-021-06060-4

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12879-021-06060-4

Keywords

BMC Infectious Diseases

ISSN: 1471-2334

Contact us