Skip to main content

Correction to: Rapid and simple colorimetric detection of multiple influenza viruses infecting humans using a reverse transcriptional loopmediated isothermal amplification (RT-LAMP) diagnostic platform

The Original Article was published on 01 August 2019

Correction to: BMC Infect Dis 19, 676 (2019)

https://doi.org/10.1186/s12879-019-4277-8

Following publication of the original article [1], the authors noticed that in Table 1, two primer sequences (B-LF and H5-LF) should have been reverse complemented.

Table 1 Reverse transcriptional loop-mediated isothermal amplification (RT-LAMP) primers for detection of influenza subtypes

The sequences to correct are below marked:

The correct sequences should be indicated as below:

No.

Needs Correction:

Corrected version

1.

Table 1/ B (NA gene)/B-LF Sequence:

GATGTCCGTGTAAGATACCAA

CTACAGGCACATTCTATGGTT

Comment: Based on the reference in designing the forward loop (LF) primer: LF 5′-AACCATAGAATGTGCCTGTAG-3′ (Figure 1, page 4), this identified sequence should have been reverse complemented however inadvertently the submitted sequence for the mentioned B-LF primer was only reversed.

2.

Table 1/ A/H5 (HA gene)/ H5-LF Sequence:

CTACCAACCATACCCATGG

GGTACCCATACCAACCATC

Comment: Based on the reference in designing the forward loop (LF) primer: LF 5′–GATGGTTGGTATGGGTACC-3′ (Figure 1, page 4), this identified sequence should have been reverse complemented however inadvertently the submitted sequence for the mentioned H5-LF primer was only reversed.

Reference

Author information

Authors and Affiliations

Authors

Corresponding authors

Correspondence to Young Ki Choi or Min-Suk Song.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Ahn, S.J., Baek, Y.H., Lloren, K.K.S. et al. Correction to: Rapid and simple colorimetric detection of multiple influenza viruses infecting humans using a reverse transcriptional loopmediated isothermal amplification (RT-LAMP) diagnostic platform. BMC Infect Dis 20, 965 (2020). https://doi.org/10.1186/s12879-020-05707-y

Download citation

  • Published:

  • DOI: https://doi.org/10.1186/s12879-020-05707-y