Open Access
Open Peer Review

This article has Open Peer Review reports available.

How does Open Peer Review work?

Multiplex detection in tonsillar tissue of all known human polyomaviruses

Contributed equally
BMC Infectious DiseasesBMC series – open, inclusive and trusted201717:409

https://doi.org/10.1186/s12879-017-2479-5

Received: 23 November 2016

Accepted: 22 May 2017

Published: 8 June 2017

Abstract

Background

In the past few years, eleven new human viruses have joined the two previously known members JCPyV and BKPyV of the Polyomaviridae family, by virtue of molecular methods. Serology data suggest that infections with human polyomaviruses (HPyVs) occur since childhood and the viruses are widespread in the general population. However, the viral persistence sites and transmission routes are by and large unknown. Our previous studies demonstrated that the four new HPyVs – KIPyV, WUPyV, MCPyV and TSPyV – were present in the tonsils, and suggested lymphoid tissue as a persistent site of these emerging human viruses.

We developed a Luminex-based multiplex assay for simultaneous detection of all 13 HPyVs known, and explored their occurrence in tonsillar tissues of children and adults mostly with tonsillitis or tonsillar hypertrophy.

Methods

We set up and validated a new Luminex-based multiplex assay by using primer pairs and probes targeting the respective HPyV viral protein 1 (VP1) genes. With this assay we tested 78 tonsillar tissues for DNAs of 13 HPyVs.

Results

The multiplex assay allowed for simultaneous detection of 13 HPyVs with high analytical sensitivity and specificity, with detection limits of 100–102 copies per microliter, and identified correctly all 13 target sequences with no cross reactions. HPyV DNA altogether was found in 14 (17.9%) of 78 tonsils. The most prevalent HPyVs were HPyV6 (7.7%), TSPyV (3.8%) and WUPyV (3.8%). Mixed infection of two HPyVs occurred in one sample.

Conclusions

The Luminex-based HPyV multiplex assay appears highly suitable for clinical diagnostic purposes and large-scale epidemiological studies. Additional evidence was acquired that the lymphoid system plays a role in HPyV infection and persistence. Thereby, shedding from this site during reactivation might take part in transmission of the newly found HPyVs.

Keywords

HPyV PCR Luminex Tonsil

Background

Thirteen human polyomaviruses (HPyVs) have been identified to date. Up to 2007, only two HPyVs had been introduced by cell culture: BK polyomavirus (BKPyV) and JC polyomavirus (JCPyV), coincidentally in 1971 [1, 2]. Since then, eleven HPyVs have been discovered by modern molecular techniques [314]. All HPyVs have high seroprevalences in human populations ranging from 40 to 90% in adults [1526]. Typically, the primary infections occur asymptomatically during childhood and are followed by lifelong DNA persistence. In immunocompromised hosts some of these viruses give rise to severe disorders such as nephropathy, progressive multifocal leukoencephalopathy, Merkel cell carcinoma or trichodysplasia spinulosa [5, 7, 27, 28]. The other HPyVs, i.e. KIPyV, WUPyV, HPyV6, HPyV7, HPyV9, HPyV10 (MWPyV), Saint Louis polyomavirus (STLPyV), HPyV12 and New Jersey polyomavirus (NJPyV)-2013, have up to date not been definitively associated with specific diseases.

On the other hand, evidence suggests that tonsils are permissive for JCPyV and BKPyV, indicating that this tissue might play a role in the viral persistence [2934]. KIPyV and WUPyV, the first two novel polyomaviruses discovered in the respiratory secretions of children with acute respiratory symptoms, [3, 4] might also remain in lymphoid tissue as suggested by detection of the corresponding sequences in tonsils [29, 35, 36]. We have reported the occurrence of DNA of MCPyV and TSPyV in tonsillar tissue, suggesting persistence in lymphoid tissue or mucosa [36, 37]. MCPyV is a common skin commensal and causes about 80% of cases of Merkel cell carcinoma (MCC) [5, 3840]. TSPyV induces the rare skin disease trichodysplasia spinulosa (TS) in immunocompromised patients [7]. HPyV6 and HPyV7 identified in skin and eyebrow hairs, have in one study been isolated from malignant and non-malignant tonsils [6, 38, 4042]. HPyV9 was identified in 2010 in the serum of a kidney transplant patient under immunosuppressive treatment [8]. Its DNA was found in serum, PBMCs and skin [38, 43, 44]. HPyV10 was originally detected in stool, while the isolate MWPyV was first encountered in the skin of a patient with the “warts, hypogammaglobulinaemia, infections and myelokathexis” (WHIM) syndrome. MXPyV, another HPyV10 isolate, was found in stool and in respiratory samples, [9, 10, 45] while STLPyV DNA was amplified in stool and urine [13]. A STLPyV variant sharing 92% genome identity with the originally described MA138 and WD972 strains, was amplified from skin warts of a patient suffering from WHIM syndrome [46]. HPyV12 was found in organs of the digestive tract, particularly in the liver but also in colon, rectum and stool [47]. NJPyV DNA sequences and virions were originally detected in a muscle biopsy of a pancreatic transplant recipient with viral sequences also found in endothelial cells in muscle and skin [48].

To demonstrate clinical correlates and disease associations for HPyVs, as with most other viruses, the diagnostic cornerstones are nucleic acid detection and serodiagnosis. To this end, we have developed and validated several PCR protocols [37, 4951]. The Luminex technology offers a novel platform for sensitive and specific, high-throughput multiplex DNA detection. An assay has earlier been set up for the detection of 10 HPyVs [52, 53]. We here describe the further development of this multiplex nucleic acid assay for the detection of all 13 HPyVs currently known, in a clinically applicable format. By combining multiplex PCR amplification with bead based hybridization and flow cytometric analysis, the resulting Luminex-based multiplex assay can simultaneously identify all the 13 HPyVs in a single reaction.

Herein, the multiplex assay is evaluated for specificity, sensitivity and reproducibility. Furthermore, we aimed to determine to what extent the lymphoid system plays a role in HPyV infection and persistence by exploring the frequencies of occurrence of these viral genomes in tonsillar biopsies from children and adults with tonsillar disease.

Methods

Clinical specimens

The clinical material comprised tonsillar tissue from 78 subjects: 31 children and 47 adults (Fig. 1). The pediatric donors ranged in age from 2 to 15 years (average, 6.6), and the adults from 16 to 69 (average, 30.3). Of the specimens, 31 were from males and 47 from females (Fig. 1). The tonsillectomies and tonsillotomies were performed in most cases due to chronic tonsillitis or tonsillar hypertrophy (Fig. 1). All tissues were collected and used in accordance with the ethical rules of the Ethics Committee of the Hospital District of Helsinki and Uusimaa. All tonsil tissues were freshly obtained directly after surgical resection at the operation theatre. The tonsils were cut with disposable scalpels and cell suspensions were prepared by mechanical homogenisation with a syringe plunge, followed by a wash with PBS and filtration through a 70 μm mesh (Corning Life Sciences). The cells were resuspended into final volume of 100 μL PBS.
Fig. 1

Tonsillar samples from children and adults; clinical indications

Nucleic acid extraction

Whole DNA was extracted from cell suspension by the KingFisher Duo DNA Extraction Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Standard precautions to avoid contamination were taken. The extracted DNA was stored at −20 °C.

Primer pairs and probes

Primer pairs and probes for 13 HPyVs (BKPyV, JCPyV, KIPyV, WUPyV, MCPyV, HPyV6, HPyV7, TSPyV, HPyV9, HPyV10 (MWPyV), STLPyV, HPyV12 and NJPyV), were based on GenBank sequences (Table 1). The primers and probes for the first 10 except MCPyV were the same as published by Gustafsson et al. [53] while the primers and probes for STLPyV, HPyV12 and NJPyV were designed for the present study. Primers for MCPyV were reselected due to dimerization of the published primers with primers for STLPyV. The primers were designed in current study by using the Amplify 3X software, version 3.1.4 (Bill Engels, University of Wisconsin) and assessed using an online NCBI Blast analysis. The 5′ ends of the reverse primers of the viral protein 1 (VP1) region were labeled with biotin (5′ biotinylation). The probes were 5′ amine-C12-modified (5′ Aminolink C12).
Table 1

Sequences of primers and probes, amplicon sizes, amplicon positions (in VP1 region) in target genome and reference strain used in the 13-plex Luminex assay [59]

Virus

Forward/Reverse (5′ biotinylated) Primers sequence (5′-3′)

Probe (5′ amine-C12) sequence (5′-3′)

Amplicon length (bp)

Amplicon position (bp) in target genome

Reference strain (GenBank accession no.)

JCPyV

AATGAGGATCTAACCTGTGGAA/CTGCACCATTGTCATGAGTTGCTTG

ATGAATGTGCACTCTAATGG

127

1742–1868

J02226

BKPyV

ACAGAGGTTATTGGAATAACTAG/ACTCCCTGCATTTCCAAGGG

CTTAACCTTCATGCAGGGTC

143

1952–2094

DQ305492

KIPyV

TTGGATGAAAATGGCATTGG/TAACCCTTCTTTGTCTAAAATGTAGCC

CTTGGAACAGCTAATAGTAGAATC

142

2263–2404

EF127906

WUPyV

TTGGATGAAAATGGCATTGG/TAACCCTTCTTTGTCTAAAATGTAGCC

GAGTACATACAGGGCTTTCCAG

142

2411–2552

EF444554

MCPyV

TTCCATCTTTATCTAATTTTGCTT/AGGCCTAGTTTTAGATTACCAGAC

GTAATAGGCCCACCATTTGT

144

3757–3900

EU375803

HPyV6

TTGCTTCTGGATCCAATACTGC/GGCCTCAGGAATTTCAGGCAA

TGGATGCTGGTTCATCTCTG

131

1426–1556

HM011558

HPyV7

AAGCAGCTACAACTGGGAACTT/GGCCTCAGGAATTTCAGGCAA

GCCTACCTTATCCTATGAGTG

125

1450–1574

HM011566

TSPyV

AGAATGTATGATGACAAAGGTAT/TCTGTAGTTTCCAGTTAGAAAC

TGAGGGAATGAATTTCCATATGTT

111

1722–1832

GU989205

HPyV9

ATCTATGGCTCATCCTCAGG/GTAGAGCTAGCAACTAGGCCT

AGTGCAGGGTACCACTCTC

107

1862–1968

KC831440

HPyV10

GTCCAGTTCCTACTAAAGTTCCT/TACATCATTGCCCATCCTTGGTT

GCCGGACACCACAATGACA

106

1501–1628

JQ898292

STPyV

TGAATATGATCCGTGCCAAA/ACTGCATCAGGGCCTACTTG

CCTCCTCCAACATGTGTTCC

129

1318–1446

JX463184

HPyV12

GTAATGGCACCCAAGAGGAA/GGGGATTTAGAAAGGCCTCA

CCCAGCAGTGTCCCTAAATT

157

1402–1558

JX308829

NJPyV

TGTGTGCCAAAGAAGTGTCCT/TCTGTCACCTGTTGGAGCATT

CTGATGCTACTACTGAAATTGAA

159

1113–1271

KF954417

Sequences for primers and probes for all except MCPyV, STPyV, HPyV12 and NJPyV as in Gustafsson et al [53].

Plasmid clones

For use as positive controls and to determine assay sensitivities by limiting dilution analysis, plasmids containing each HPyV genome were used. Plasmid DNA was purified using the High Pure Plasmid Isolation Kit (Roche Diagnostics). The concentration of the purified plasmid DNA was determined with the NanoDrop 2000 (Invitrogen, Carlsbad, CA, USA) and the corresponding genome copies were calculated based on the concentration and molecular weight of the plasmid. A 10-fold dilution series of 108 to 100 copies/μL of HPyV DNA was prepared for each of the 13 HPyVs in PCR-grade H2O, aliquoted, and stored at −20 °C.

Multiplex PCR for HPyV detection using the Luminex platform

All the HPyV assays were at first performed in singleplex format and then multiplexed. After confirming that each individual primer pair amplified specifically its plasmid sequence, the primer pairs were combined. The multiplex nucleic acid amplification was conducted as below. In brief, 5 μL DNA templates were mixed in a 20 μL multiplex reaction consisting of 12.5 μL of 2× multiplex PCR mastermix (Qiagen), 0.2 μM of each forward primer and 1 μM of each biotinylated reverse primer. The amplification conditions were 95 °C for 15 min, 40 cycles at 94 °C for 20 s, 50 °C for 90 s, 71 °C for 1 min and 20 s, and a final extension at 71 °C for 10 min.

HPyV singleplex nested PCR

Each positive specimen was amplified and confirmed with the corresponding HPyV singleplex nested PCR (JCPyV, WUPyV, MCPyV, HPyV, and TSPyV). PCR-grade H2O was included in each experiment. In brief, 3 μL of amplified DNA template was mixed in a 22 μL multiplex reaction consisting of 12.5 μL of 2× multiplex PCR mastermix (Qiagen), 0.2 μM of the corresponding forward primer and 0.2 μM of the corresponding biotinylated reverse primer. The amplification conditions were the same as with the multiplex PCR.

Luminex-based suspension array procedure (oligonucleotide coupling, hybridization, and measurement)

Oligonucleotide coupling; thirteen capture probes were included in the multiplex assay (Table 1). Each probe sequence represented the reverse complement to the target region of the biotinylated PCR product. Different sets of carboxylated fluorescent microbeads were obtained from Luminex Corp. (‘s-Hertogenbosch, The Netherlands), and oligonucleotide probes for target viruses were assigned to individual bead sets. The oligonucleotide coupling was done according to the manufacturer’s instructions (xMAP cookbook, Luminex). The probe-coupled beads were counted using a hemocytometer and were stored in the dark at +4 °C. Hybridization; probe-beads and PCR products were hybridized as published [53] except that the streptavidin-phycoerythrin (SAPE, Invitrogen) incubation temperature was 48 °C. After three washes the amplicons were labeled with 4 μg/mL SAPE conjugate in 2 M tetramethylammonium chloride (Sigma), 75 mM Tris, 6 mM EDTA and 1.5 g7 L sarkosyl (Sigma), pH 8.0; for 20 min in the dark. Measurement; after three washes, the beads and the SAPE signal were analyzed in a Bio-Plex 200 (Bio-Rad).

Data analysis and cutoff definition

The results were measured and calculated by the software Xponent 2.1. The data were expressed as Median Fluorescence Intensity (MFI) of 100 microspheres of each bead type. The cut-off value for a positive result was defined as net MFI two times background mean plus 15 MFI.

Specificity of HPyV multiplex assay

To evaluate the specificity of the multiplex assay, plasmids of each HPyV alone (at 105 copies/μL) and combined were used as template to hybridize with a mixture of 13 type-specific probe-bead sets. Specificity of the multiplex platform was also investigated with virus-free SF9 and HEK 293 cells.

Detection limits of HPyV multiplex assay

To determine the sensitivity of the single and multiplex assays, we tested each virus with 10-fold serial dilutions of the DNA standards. The detection limit was defined as the dilution containing the fewest copies of viral genome (in duplicate testing) that still gave a positive result.

Reproducibility of HPyV multiplex assay

To test the multiplex assay reproducibility, a mixture of all 13 HPyV plasmids (at 103 copies/μL/each HPyV) was analyzed with a mixture of 13 type-specific probe-bead sets. Intra-assay variation was calculated with triplicates in the same run, and inter-assay variation in 3 distinct runs.

Results

We designed a multiplex assay for the detection and identification of 13 HPyVs, by extension of a previously designed multiplex assay for 10 HPyVs [53]. The assay conditions in this study were optimized for the following parameters: amounts of HPyV-specific probes, each coupled to a distinct Luminex bead, amounts of forward primer and biotinylated reverse primer; hybridization conditions; SAPE concentration; incubation time for SAPE staining; and numbers of washing cycles (data not shown).

Specificity of HPyV multiplex assay

PCR-grade H2O was included in each experiment to determine background. Specificity of the assay was assessed with plasmids containing the respective HPyV VP1 inserts. Plasmids of each of the 13 HPyVs alone and combined (105 copies/μl/each HPyV) were used as template for singleplex/multiplex amplification and hybridization. The multiplex assay did identify correctly all the 13 target sequences, with no cross reactions (Table 2). Furthermore, we tested the specificity of the multiplex assay with virus-free SF9 and HEK 293 cells, with no positive signals obtained (data not shown).
Table 2

Specificities of 13 type-specific probes employed in multiplex HPyV genotyping

Target sequence

HPyV type-specific probe (MFI)

BKPyV

JCPyV

KIPyV

WUPyV

MCPyV

HPyV6

HPyV7

TSPyV

HPyV9

HPyV10

HPyV11

HPyV12

HPyV13

BKPyV

2105

43

35

36

33

54

42

27

34

34

44

35

19

JCPyV

39

1145

32

32

32

34

34

24

39

28

47

32

20

KIPyV

49

48

2522

45

42

43

43

38

48

44

59

47

17

WUPyV

33

36

29

5704

31

31

65

18

35

26

43

29

19

MCPyV

46

46

37

38

2736

45

41

31

40

37

49

39

21

HPyV6

38

38

34

32

33

3196

35

30

34

31

44

35

23

HPyV7

43

46

38

52

35

42

2574

29

41

41

51

37

18

TSPyV

52

52

45

74

42

46

64

2894

47

42

58

47

19

HPyV9

50

48

44

40

47

47

39

29

1388

39

54

49

18

HPyV10

38

36

33

32

34

36

32

21

33

5116

47

31

24

HPyV11

47

56

42

51

45

66

61

57

59

58

1782

66

17

HPyV12

55

50

42

48

45

50

46

38

46

39

61

681

20

HPyV13

39

42

36

36

37

39

40

27

40

35

48

37

2327

Mix HPyVs

745

1367

1518

2884

1511

1586

1125

733

603

2639

612

326

1631

cutoff

85

81

77

81

77

83

77

75

81

72

107

73

127

Each line represents a single well with each HPyV plasmid (105 copies/μL) or plasmid mix hybridized to a mixture of 13 distinct beads

Limit of detection of HPyV multiplex assay

To determine the sensitivities of the single- and multiplex assays, each HPyV plasmid was diluted serially from 108 to 100 in PCR-grade H2O. The limit of detection was the dilution containing the fewest copies in duplicate of viral genome that still gave a positive result. The analytical sensitivities in singleplex and multiplex format ranged from 100 to 102 copies per microliter with all 13 HPyVs (Table 3).
Table 3

Limits of detection of 13 HPyVs in singleplex and multiplex format

HPyV

Limits of detection per μL of DNA extract

Singleplex

Multiplex

BKPyV

101

101

JCPyV

101

101

KIPyV

101

101

WUPyV

101

101

MCPyV

101

102

HPyV6

101

101

HPyV7

102

102

TSPyV

101

101

HPyV9

101

102

HPyV10

100

101

HPyV11

101

102

HPyV12

100

101

HPyV13

101

101

Intra-assay and inter-assay reproducibility of HPyV multiplex assay

The reproducibility of HPyV multiplex assay was determined with a mixture of all 13 HPyV plasmids (103 copies/μL/each HPyV) and a mixture of 13 type-specific probe-bead sets. The coefficient of variation obtained from triplicates in a single run ranged from 2.9% to 9.2% and from three independent runs ranged from 5.7% to 18.8%.

Application of HPyV multiplex assay on tissues

The multiplex assay was applied to tonsillar samples obtained from children and adults. Among the 78 tissue donors the assay tested positive as follows: BKPyV (n = 0), JCPyV (n = 1), KIPyV (n = 0), WUPyV (n = 3), MCPyV (n = 1), HPyV6 (n = 6), HPyV7 (n = 0), TSPyV (n = 3), HPyV9 (n = 0), and HPyV10 (n = 0), STLPyV (n = 0), HPyV12 (n = 0), and NJPyV (n = 0). Co-infection of WUPyV and TSPyV was observed in one tissue. Altogether 13 specimens tested positive: JCPyV DNA was found in a female (22 year old) with tonsillitis and peritonsillar abscess; MCPyV DNA in a female (46 y) with tonsillitis; and HPyV6 DNA in 4 males and 2 females (33 y median age [range, 14 to 69]) with diverse tonsillar conditions. WUPyV DNA occurred in two children (male, aged <5 years; one with snoring and the other with hypertrophy). TSPyV DNA was detected in a 2-y child (male) with hypertrophy and an 11-y child (male) with no clinical data available. Co-infection with WUPyV and TSPyV was seen in a 6-y child (female) with hypertrophy. Each positive specimen was confirmed with the corresponding PyV singleplex nested PCR(s). No product was generated from the negative control.

Discussion

The number of HPyVs known has multiplied explosively during the past decade. Infections by these viruses appear ubiquitous since birth. Their DNAs have been found widely in the human body, including lymphoid organs, albeit in low copy numbers [5460]. Whereas JCPyV, BKPyV, MCPyV and TSPyV are known to be associated with diseases, the others are orphan as regards clinical manifestations.

The currently existing PCR assays are of limited value in multi-HPyV assessment. To this end, sensitive detection methods covering all the HPyVs are needed. By extension and optimization of an earlier one [53], we here describe the development and validation of a Luminex-based multiplex assay that allows for simultaneous detection of 13 HPyVs. The new assay exhibited a high analytical sensitivity, i.e., ability to detect all HPyVs with detection limits of 100–102 copies per microliter, and suitability for high-throughput analysis. We consider the method advantageous also for analyzing multiple infections. This was demonstrated by the detection of up to 13 types in mixes of HPyV plasmids, and of 2 HPyVs in a single tonsillar sample.

In a previous study [61] addressing the detection of members of Polyomaviride in tonsillar tissues from Chinese children with chronic tonsillar disease, WUPyV, MCPyV, TSPyV, KIPyV, MWPyV, and STLPyV were detected in eleven (11%), four (4.0%), three (3.0%), two (2.0%), two (2.0%), and two (2.0%) of 99 samples, respectively. A single HPyV infection was found in 24 (24%) of the samples, and dual HPyV infections (WUPyV and MCPyV) in 2 (2%) samples. In our previous study, we investigated 229 matched pairs of tonsillar tissue biopsies and corresponding serum samples for the presence of TSPyV and found this emerging HPyV in 8 (3.5%) tonsils, and in none of the sera [37]. Each of the 8 PCR-positive subjects had antiviral IgG of high avidity but not IgM, disclosing persistence. In the present study, we detected JCPyV, WUPyV, MCPyV, HPyV6, and TSPyV DNA altogether in 14 (18%) of 78 tonsils, and co-infection of two HPyVs (WUPyV and TSPyV) in one tissue. All of these data provide evidence of tonsils serving as shedding site in HPyV reactivation and thus contributing to HPyV transmission.

Note added in submission

After completion of our work, Herberhold et al. (Med Microbiol Immunol, DOI https://doi.org/10.1007/s00430%E2%80%93016%E2%80%930486-6) published tonsillar HPyV DNA prevalence data highly similar to ours by using real-time quantitative PCRs in singleplex format.

Conclusion

A Luminex-based multiplex assay was developed for epidemiological and diagnostic studies to address whether any of the emerging HPyVs, or infection with HPyV thereof, is associated with disease development. Based on the observed frequent occurrence of HPyVs in human tonsils, we suggest that lymphoid tissue may be a general persistence site for these viruses. Thereby, shedding from this site during reactivation might play a role in HPyV transmission.

Abbreviations

BBMA: 

Bead-based multiplex assay

BKPyV: 

BK polyomavirus

HPyVs: 

Human polyomaviruses

JCPyV: 

JC polyomavirus

MCC: 

Merkel cell carcinoma

MCPyV: 

Merkel cell polyomavirus

MFI: 

Median fluorescence intensity

NJPyV: 

New Jersey polyomavirus

SAPE: 

Streptavidin-phycoerythrin

STLPyV: 

Saint Louis polyomavirus

TS: 

Trichodysplasia spinulosa

TSPyV: 

Trichodysplasia spinulosa

VP1: 

Viral protein 1

WHIM: 

Warts, hypogammaglobulinaemia, infections and myelokathexis

Declarations

Acknowledgments

We wish to thank Eeva Auvinen for providing the JC and BK plasmids; Mariet Feltkamp the TSV; John A. Lednicky the HPyV9; James A. DeCaprio the HPyV10; Bernhard Ehlers the HPyV12; and W. Ian Lipkin the NJPyV plasmids, We are grateful to Sari Tillander at Finnish Institute of Occupational Health and Maija Lappalainen at HUSLAB for permission of use of the Bioplex devices.

Funding

This study was supported by the Sigrid Jusélius Foundation, The Jane and Aatos Erkko Foundation, The Finnish Academy, The Medical Foundation Liv och Hälsa, the Helsinki University Research Fund, The Ida Montin Foundation, and The Finnish-Norwegian Medical Foundation.

Availability of data and materials

All the data supporting our findings are contained within the manuscript. The raw datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors’ contributions

MS and YW carried out the experiments, acquired and analyzed the data, and drafted the manuscript. TR contributed to conception, study design and provision of study materials. L-MA provided tonsillar samples and the clinical data. LP and MT participated in the DNA work. MS-V and KH designed, coordinated the project, and participated in manuscript writing. All authors read, revised, and approved the final version of the manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

The study was approved by the Coordinating Ethics Committee of the Hospital District of Helsinki and Uusimaa (Dnro 450/13/03/04/08 HUS). The patients provided written consent before entry into the study.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Virology, University of Helsinki
(2)
Department of Oncology-Pathology, Karolinska Institutet
(3)
Department of Otorhinolaryngology-Head and Neck Surgery, Helsinki University Hospital
(4)
University of Helsinki
(5)
Helsinki University Hospital, HUSLAB

References

  1. Gardner SD, Field AM, Coleman DV, Hulme B. New human papovavirus (B.K.) isolated from urine after renal transplantation. Lancet. 1971;1(7712):1253–7.View ArticlePubMedGoogle Scholar
  2. Padgett BL, Walker DL, ZuRhein GM, Eckroade RJ, Dessel BH. Cultivation of papova-like virus from human brain with progressive multifocal leucoencephalopathy. Lancet. 1971;1(7712):1257–60.View ArticlePubMedGoogle Scholar
  3. Allander T, Andreasson K, Gupta S, Bjerkner A, Bogdanovic G, Persson MA, et al. Identification of a third human polyomavirus. J Virol. 2007;81(8):4130–6.Google Scholar
  4. Gaynor AM, Nissen MD, Whiley DM, Mackay IM, Lambert SB, Wu G, et al. Identification of a novel polyomavirus from patients with acute respiratory tract infections. PLoS Pathog. 2007;3(5):e64.Google Scholar
  5. Feng H, Shuda M, Chang Y, Moore PS. Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science. 2008;319(5866):1096–100.View ArticlePubMedPubMed CentralGoogle Scholar
  6. Schowalter RM, Pastrana DV, Pumphrey KA, Moyer AL, Buck CB. Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Cell Host Microbe. 2010;7(6):509–15.View ArticlePubMedPubMed CentralGoogle Scholar
  7. van der Meijden E, Janssens RW, Lauber C, Bouwes Bavinck JN, Gorbalenya AE, Feltkamp MC. Discovery of a new human polyomavirus associated with trichodysplasia spinulosa in an immunocompromized patient. PLoS Pathog. 2010;6(7):e1001024.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Scuda N, Hofmann J, Calvignac-Spencer S, Ruprecht K, Liman P, Kuhn J, et al. A novel human polyomavirus closely related to the african green monkey-derived lymphotropic polyomavirus. J Virol. 2011;85(9):4586–90.Google Scholar
  9. Buck CB, Phan GQ, Raiji MT, Murphy PM, McDermott DH, McBride AA. Complete genome sequence of a tenth human polyomavirus. J Virol. 2012;86(19):10887.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Siebrasse EA, Reyes A, Lim ES, Zhao G, Mkakosya RS, Manary MJ, et al. Identification of MW polyomavirus, a novel polyomavirus in human stool. J Virol. 2012;86(19):10321–6.Google Scholar
  11. Yu G, Greninger AL, Isa P, Phan TG, Martinez MA, de la Luz SM, et al. Discovery of a novel polyomavirus in acute diarrheal samples from children. PLoS One. 2012;7(11):e49449.Google Scholar
  12. Korup S, Rietscher J, Calvignac-Spencer S, Trusch F, Hofmann J, Moens U, et al. Identification of a novel human polyomavirus in organs of the gastrointestinal tract. PLoS One. 2013;8(3):e58021.Google Scholar
  13. Lim ES, Reyes A, Antonio M, Saha D, Ikumapayi UN, Adeyemi M, et al. Discovery of STL polyomavirus, a polyomavirus of ancestral recombinant origin that encodes a unique T antigen by alternative splicing. Virology. 2013;436(2):295–303.Google Scholar
  14. Mishra N, Pereira M, Rhodes RH, An P, Pipas JM, Jain K, et al. Identification of a novel polyomavirus in a pancreatic transplant recipient with retinal blindness and vasculitic myopathy. J Infect Dis. 2014;210(10):1595–9.Google Scholar
  15. Trusch F, Klein M, Finsterbusch T, Kuhn J, Hofmann J, Ehlers B. Seroprevalence of human polyomavirus 9 and cross-reactivity to African green monkey-derived lymphotropic polyomavirus. J Gen Virol. 2012;93:698–705.View ArticlePubMedGoogle Scholar
  16. Nicol JTJ, Touze A, Robinot R, Arnold F, Mazzoni E, Tognon M, et al. Seroprevalence and cross-reactivity of human polyomavirus 9. Emerg Infect Dis. 2012;18(8):1329–32.Google Scholar
  17. Sadeghi M, Riipinen A, Vaisanen E, Kantola K, Karikoski R, Taskinen H, Soderlund-Venermo M, Hedman K: Are the newly discovered human polyomaviruses associated with fetal death or miscarriage? J Clin Virol 2009, 46:S60.Google Scholar
  18. Sadeghi M, Riipinen A, Vaisanen E, Chen TT, Kantola K, Surcel HM, et al. Newly discovered KI, WU, and Merkel cell polyomaviruses: no evidence of mother-to-fetus transmission. Virol J. 2010;7:251.Google Scholar
  19. Sadeghi M, Aronen M, Chen TT, Jartti L, Jartti T, Ruuskanen O, et al. Merkel cell polyomavirus and trichodysplasia spinulosa-associated polyomavirus DNAs and antibodies in blood among the elderly. BMC Infect Dis. 2012;12:383.Google Scholar
  20. Kardas P, Sadeghi M, Weissbach FH, Chen TT, Hedman L, Auvinen E, et al. Inter- and Intralaboratory comparison of JC polyomavirus antibody testing using two different virus-like particle-based assays. Clin Vaccine Immunol. 2014;21(11):1581–8.Google Scholar
  21. Kantola K, Sadeghi M, Ewald MJ, Weissbrich B, Allander T, Lindau C, et al. Expression and serological characterization of polyomavirus WUPyV and KIPyV structural proteins. Viral Immunol. 2010;23(4):385–93.Google Scholar
  22. Chen TT, Mattila PS, Jartti T, Ruuskanen O, Soderlund-Venermo M, Hedman K. Seroepidemiology of the newly found Trichodysplasia Spinulosa-associated polyomavirus. J Infect Dis. 2011;204(10):1523–6.View ArticlePubMedGoogle Scholar
  23. Stolt A, Sasnauskas K, Koskela P, Lehtinen M, Dillner J. Seroepidemiology of the human polyomaviruses. J Gen Virol. 2003;84(Pt 6):1499–504.View ArticlePubMedGoogle Scholar
  24. Kean JM, Rao S, Wang M, Garcea RL. Seroepidemiology of human polyomaviruses. PLoS Pathog. 2009;5(3):e1000363.View ArticlePubMedPubMed CentralGoogle Scholar
  25. Nguyen NL, Le BM, Wang D. Serologic evidence of frequent human infection with WU and KI polyomaviruses. Emerg Infect Dis. 2009;15(8):1199–205.View ArticlePubMedPubMed CentralGoogle Scholar
  26. Egli A, Infanti L, Dumoulin A, Buser A, Samaridis J, Stebler C, et al. Prevalence of polyomavirus BK and JC infection and replication in 400 healthy blood donors. J Infect Dis. 2009;199(6):837–46.Google Scholar
  27. Hirsch HH, Steiger J. Polyomavirus BK. Lancet Infect Dis. 2003;3(10):611–23.View ArticlePubMedGoogle Scholar
  28. Tan CS, Koralnik IJ. Progressive multifocal leukoencephalopathy and other disorders caused by JC virus: clinical features and pathogenesis. Lancet Neurol. 2010;9(4):425–37.View ArticlePubMedPubMed CentralGoogle Scholar
  29. Astegiano S, Terlizzi ME, Elia M, Cavallo GP, Costa C, Cavallo R, et al. Prevalence of polyomaviruses BK, JC, SV40, KI, and WU in non-malignant tonsil specimens. Minerva Med. 2010;101(6):385–9.Google Scholar
  30. Comar M, Zanotta N, Bovenzi M, Campello C. JCV/BKV and SV40 viral load in lymphoid tissues of young immunocompetent children from an area of north-east Italy. J Med Virol. 2010;82(7):1236–40.View ArticlePubMedGoogle Scholar
  31. Meneses A, Lopez-Terrada D, Zanwar P, Killen DE, Monterroso V, Butel JS, et al. Lymphoproliferative disorders in Costa Rica and simian virus 40. Haematologica. 2005;90(12):1635–42.Google Scholar
  32. Monaco MC, Jensen PN, Hou J, Durham LC, Major EO. Detection of JC virus DNA in human tonsil tissue: evidence for site of initial viral infection. J Virol. 1998;72(12):9918–23.PubMedPubMed CentralGoogle Scholar
  33. Monaco MC, Atwood WJ, Gravell M, Tornatore CS, Major EO. JC virus infection of hematopoietic progenitor cells, primary B lymphocytes, and tonsillar stromal cells: implications for viral latency. J Virol. 1996;70(10):7004–12.PubMedPubMed CentralGoogle Scholar
  34. Kato A, Kitamura T, Takasaka T, Tominaga T, Ishikawa A, Zheng HY, et al. Detection of the archetypal regulatory region of JC virus from the tonsil tissue of patients with tonsillitis and tonsilar hypertrophy. J Neuro-Oncol. 2004;10(4):244–9.Google Scholar
  35. Babakir-Mina M, Ciccozzi M, Bonifacio D, Bergallo M, Costa C, Cavallo R, et al. Identification of the novel KI and WU polyomaviruses in human tonsils. J Clin Virol. 2009;46(1):75–9.Google Scholar
  36. Kantola K, Sadeghi M, Lahtinen A, Koskenvuo M, Aaltonen LM, Mottonen M, et al. Merkel cell polyomavirus DNA in tumor-free tonsillar tissues and upper respiratory tract samples: implications for respiratory transmission and latency. J Clin Virol. 2009;45(4):292–5.Google Scholar
  37. Sadeghi M, Aaltonen LM, Hedman L, Chen T, Soderlund-Venermo M, Hedman K. Detection of TS polyomavirus DNA in tonsillar tissues of children and adults: evidence for site of viral latency. J Clin Virol. 2014;59(1):55–8.Google Scholar
  38. Hampras SS, Giuliano AR, Lin HY, Fisher KJ, Abrahamsen ME, McKay-Chopin S, et al. Natural history of polyomaviruses in men: the HPV infection in men (HIM) study. J Infect Dis. 2015;211(9):1437–46.Google Scholar
  39. Gunel C, Kirdar S, Omurlu IK, Agdas F. Detection of the Epstein-Barr virus, human Bocavirus and novel KI and KU polyomaviruses in adenotonsillar tissues. Int J Pediatr Otorhinolaryngol. 2015;79(3):423–7.View ArticlePubMedGoogle Scholar
  40. Bellaud G, Gheit T, Pugin A, Pretet JL, Tommasino M, Mougin C, et al. Prevalence of human polyomavirus DNA in eyebrow hairs plucked from patients with psoriasis treated with TNF inhibitors. J Eur Acad Dermatol Venereol. 2015;29(5):1019–21.Google Scholar
  41. Salakova M, Koslabova E, Vojtechova Z, Tachezy R, Sroller V. The detection of human polyomaviruses MCPyV, HPyV6, and HPyV7 in malignant and non-malignant tonsillar tissues. J Med Virol. 2016;88(4):695–702.Google Scholar
  42. Wieland U, Silling S, Hellmich M, Potthoff A, Pfister H, Kreuter A. Human polyomaviruses 6, 7, 9, 10 and Trichodysplasia spinulosa-associated polyomavirus in HIV-infected men. J Gen Virol. 2014;95:928–32.Google Scholar
  43. van der Meijden E, Wunderink HF, van der Blij-de Brouwer CS, Zaaijer HL, Rotmans JI, Bavinck JN, et al. Human polyomavirus 9 infection in kidney transplant patients. Emerg Infect Dis. 2014:20(6):991–9.Google Scholar
  44. Lednicky JA, Butel JS, Luetke MC, Loeb JC. Complete genomic sequence of a new human polyomavirus 9 strain with an altered noncoding control region. Virus Genes. 2014;49(3):490–2.View ArticlePubMedGoogle Scholar
  45. Yu GX, Greninger AL, Isa P, Phan TG, Martinez MA, Sanchez MD, Contreras JF, Santos-Preciado JI, Parsonnet J, Miller S et al. Discovery of a Novel Polyomavirus in Acute Diarrheal Samples from Children. PLoS One 2012;7(11):e49449.Google Scholar
  46. Pastrana DV, Fitzgerald PC, Phan GQ, Raiji MT, Murphy PM, McDermott DH, et al. A divergent variant of the eleventh human polyomavirus species, saint louis polyomavirus. Genome Announcements. 2013:1(5).Google Scholar
  47. Korup S, Rietscher J, Calvignac-Spencer S, Trusch F, Hofmann J, Moens U, et al. Identification of a Novel Human Polyomavirus in Organs of the Gastrointestinal Tract. PLoS One. 2013;8(3):e58021.Google Scholar
  48. Mishra N, Pereira M, Rhodes RH, An P, Pipas JM, Jain K, et al. Identification of a Novel Polyomavirus in a Pancreatic Transplant Recipient With Retinal Blindness and Vasculitic Myopathy. J Infect Dis. 2014.Google Scholar
  49. Kantola K, Sadeghi M, Lahtinen A, Koskenvuo M, Aaltonen LM, Mottonen M, et al. Merkel cell polyomavirus DNA in tumor-free tonsillar tissues and upper respiratory tract samples: implications for respiratory transmission and latency. J Clin Virol. 2009;45(4):292–5.Google Scholar
  50. Sadeghi M, Aronen M, Chen T, Jartti L, Jartti T, Ruuskanen O, et al. Merkel cell polyomavirus and trichodysplasia spinulosa-associated polyomavirus DNAs and antibodies in blood among the elderly. BMC Infect Dis. 2012;12:383.Google Scholar
  51. Sadeghi M, Riipinen A, Vaisanen E, Chen T, Kantola K, Surcel HM, et al. Newly discovered KI, WU, and Merkel cell polyomaviruses: no evidence of mother-to-fetus transmission. Virol J. 2010;7:251.Google Scholar
  52. Ramqvist T, Nordfors C, Dalianis T, Ragnarsson-Olding B. DNA from human polyomaviruses, TSPyV, MWPyV, HPyV6, 7 and 9 was not detected in primary mucosal melanomas. Anticancer Res. 2014;34(2):639–43.PubMedGoogle Scholar
  53. Gustafsson B, Priftakis P, Rubin J, Giraud G, Ramqvist T, Dalianis T. Human polyomaviruses were not detected in cerebrospinal fluid of patients with neurological complications after hematopoietic stem cell transplantation. Future Virol. 2013;8(8):809–14.View ArticleGoogle Scholar
  54. Rinaldo CH, Tylden GD, Sharma BN. The human polyomavirus BK (BKPyV): virological background and clinical implications. APMIS. 2013;121(8):728–45.View ArticlePubMedGoogle Scholar
  55. Rinaldo CH, Hirsch HH. The human polyomaviruses: from orphans and mutants to patchwork family. APMIS. 2013;121(8):681–4.View ArticlePubMedGoogle Scholar
  56. Kazem S, van der Meijden E, Feltkamp MC. The trichodysplasia spinulosa-associated polyomavirus: virological background and clinical implications. APMIS. 2013;121(8):770–82.View ArticlePubMedGoogle Scholar
  57. Hirsch HH, Kardas P, Kranz D, Leboeuf C. The human JC polyomavirus (JCPyV): virological background and clinical implications. APMIS. 2013;121(8):685–727.View ArticlePubMedGoogle Scholar
  58. Ehlers B, Wieland U. The novel human polyomaviruses HPyV6, 7, 9 and beyond. APMIS. 2013;121(8):783–95.View ArticlePubMedGoogle Scholar
  59. Coursaget P, Samimi M, Nicol JT, Gardair C, Touze A. Human Merkel cell polyomavirus: virological background and clinical implications. APMIS. 2013;121(8):755–69.View ArticlePubMedGoogle Scholar
  60. Babakir-Mina M, Ciccozzi M, Perno CF, Ciotti M. The human polyomaviruses KI and WU: virological background and clinical implications. APMIS. 2013;121(8):746–54.View ArticlePubMedGoogle Scholar
  61. Peng J, Li K, Zhang C, Jin Q. MW polyomavirus and STL polyomavirus present in tonsillar tissues from children with chronic tonsillar disease. Clin Microbiol Infect. 2016;22(1):97.e1-3.Google Scholar

Copyright

© The Author(s). 2017

Advertisement