Skip to main content

Table 1 Sequences of primers and probes, amplicon sizes, amplicon positions (in VP1 region) in target genome and reference strain used in the 13-plex Luminex assay [59]

From: Multiplex detection in tonsillar tissue of all known human polyomaviruses

Virus Forward/Reverse (5′ biotinylated) Primers sequence (5′-3′)
Probe (5′ amine-C12) sequence (5′-3′)
Amplicon length (bp) Amplicon position (bp) in target genome Reference strain (GenBank accession no.)
JCPyV AATGAGGATCTAACCTGTGGAA/CTGCACCATTGTCATGAGTTGCTTG
ATGAATGTGCACTCTAATGG
127 1742–1868 J02226
BKPyV ACAGAGGTTATTGGAATAACTAG/ACTCCCTGCATTTCCAAGGG
CTTAACCTTCATGCAGGGTC
143 1952–2094 DQ305492
KIPyV TTGGATGAAAATGGCATTGG/TAACCCTTCTTTGTCTAAAATGTAGCC
CTTGGAACAGCTAATAGTAGAATC
142 2263–2404 EF127906
WUPyV TTGGATGAAAATGGCATTGG/TAACCCTTCTTTGTCTAAAATGTAGCC
GAGTACATACAGGGCTTTCCAG
142 2411–2552 EF444554
MCPyV TTCCATCTTTATCTAATTTTGCTT/AGGCCTAGTTTTAGATTACCAGAC
GTAATAGGCCCACCATTTGT
144 3757–3900 EU375803
HPyV6 TTGCTTCTGGATCCAATACTGC/GGCCTCAGGAATTTCAGGCAA
TGGATGCTGGTTCATCTCTG
131 1426–1556 HM011558
HPyV7 AAGCAGCTACAACTGGGAACTT/GGCCTCAGGAATTTCAGGCAA
GCCTACCTTATCCTATGAGTG
125 1450–1574 HM011566
TSPyV AGAATGTATGATGACAAAGGTAT/TCTGTAGTTTCCAGTTAGAAAC
TGAGGGAATGAATTTCCATATGTT
111 1722–1832 GU989205
HPyV9 ATCTATGGCTCATCCTCAGG/GTAGAGCTAGCAACTAGGCCT
AGTGCAGGGTACCACTCTC
107 1862–1968 KC831440
HPyV10 GTCCAGTTCCTACTAAAGTTCCT/TACATCATTGCCCATCCTTGGTT
GCCGGACACCACAATGACA
106 1501–1628 JQ898292
STPyV TGAATATGATCCGTGCCAAA/ACTGCATCAGGGCCTACTTG
CCTCCTCCAACATGTGTTCC
129 1318–1446 JX463184
HPyV12 GTAATGGCACCCAAGAGGAA/GGGGATTTAGAAAGGCCTCA
CCCAGCAGTGTCCCTAAATT
157 1402–1558 JX308829
NJPyV TGTGTGCCAAAGAAGTGTCCT/TCTGTCACCTGTTGGAGCATT
CTGATGCTACTACTGAAATTGAA
159 1113–1271 KF954417
  1. Sequences for primers and probes for all except MCPyV, STPyV, HPyV12 and NJPyV as in Gustafsson et al [53].