Skip to main content

Evaluation of the relationship between IL-12, IL-13 and TNF-α gene polymorphisms with the susceptibility to brucellosis: a case control study



The cytokine gene polymorphism is important for the genetic susceptibility of infectious diseases. The aim of the present study was to investigate the relationship between TNF-α, IL-12, and IL-13 gene polymorphisms and predisposition to brucellosis.


In this study, 107 patients with brucellosis and 107 healthy individuals were evaluated. The SNPs of TNF-α)- 238 G/A) and IL-12 (+ 1188 A/C) were done by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) and IL-13 genotyping at positions − 1512 (A/C) and − 1112 (C/T) were analysis by restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR) methods. IL-12, IL-13 and TNF-α serum levels were measured by a sandwich enzyme-linked immunosorbent assay (ELISA).


IL-13 (−1512A/C) was associated with Brucellosis risk in dominant model (OR (95% CI) = 2.17 (1.02–4.62)), P-value = 0.041. However, there was no difference in allele and genotype frequencies of TNF-α)- 238 G/A), IL-12 (+ 1188 A/C) and IL-13 [− 1512 (A/C) and − 1112 (C/T)] between patients and controls. Serum levels of IL-12 and TNF-α were significantly more frequent in the patients than in the control groups.


The IL-13 gene polymorphism can be used as a biomarker for detecting susceptibility to Brucella disease.

Peer Review reports


Brucella spp. are Gram-negative, non-spore forming, non-motile, facultative intracellular bacteria, which cause an infectious disease called Brucellosis [1]. Transmission of these bacteria to humans through the use of unpasteurized dairy products and inhalation of contaminated aerosols with infected animal [2, 3]. Clinical features of active brucellosis in humans included fever, sweating, weight loss, arthralgia, hepatomegaly, splenomegaly, headache, endocarditis and clinical manifestations in domestic animal in both female and males include abortion, vaginal secretions, placenta retention, low fertility rate, epididymitis, infertility, sperm abnormalities. Abortion often has symptoms of placental retention and metritis that may cause infertility [4,5,6,7]. The disease in areas like the Middle East, Eastern Europe, Africa, Latin America is endemic [8, 9].

Hamadan province is one of the high prevalent cities in western Iran [10]. Cytokines set the pathway for adaptive immune responses [11]. Studies have shown that reducing or increasing the expression of cytokines can play a major role in pathogenicity. Moreover, protection in this disease is carried out by T-Helper 1 cells (Th1) while T-Helper 2 cells (Th2) response is effective in exacerbating the disease [12]. Upon infection, phagocytes are activated to produce proinflammatory cytokines including Tumor necrosis factor-a (TNF-a) and Interleukin-12 (IL-12). Interleukin 12 to produce interferon gamma, which stimulates the response of Th1 and activates macrophages. Activated macrophages can kill intracellular Brucella and eliminate the infection [13, 14]. Similar IFN-γ, TNF-a as well as is a vital agent for the clearance of brucellosis infection from the host [15]. IL-12, is one of the inherent immune inflammatory cytokines, plays a major role in controlling infection in intracellular bacteria. This cytokine is a central cytokine in the differentiation of Th1 cells [16]. IL-13 is pivotal pro-inflammatory cytokines and down-regulates Th1 responses. Consequently this cytokine promotes intracellular infection [17]. Genetic variation in interleukin 12, interlukin-13 and TNF-α has been studied in various diseases including mycobacterial infection, type1diabetes, periodontitis, viral diseases and autoimmune disorders [18,19,20,21,22]. Polymorphisms in the genes of cytokines can increase or decrease their expression and affect the determination of acute or chronic disease [23]. Since genetic variation in various populations and the presence of specific polymorphisms in patients, understanding the cytokine pattern as an important factor in the clinical outcome of brucellosis infection can be effective in controlling the disease. The aim of the present study was to investigated the association between TNF-α)- 238 G/A), IL-12 (+ 1188 A/C), and IL-13 (− 1512 A/C and − 1112 C/T) gene polymorphisms and their serum levels and susceptibility to brucellosis comparison to healthy subjects.


Patients and controls

This study was performed in the Infectious Diseases Unit at Sina Hospital of Hamadan province, Iran. Between December 2017 and June 2018. The present study included 107 patients (79 men and 28 women) with brucellosis (age range 17–78 years and mean ± SD = 43.63 ± 16.21) and 107 healthy individuals as a control group (76 men and 31 women, age range 20–60 and mean ± SD = 36.37 ± 9.11). Diagnosis of brucellosis was based on clinical findings, positive serological tests and positive blood cultures or PCR [24].

Inclusion criteria for healthy people included no previous contact with animals, no consumption of unpasteurized dairy products and without any clinical symptoms and exclusion criteria were any antibody to brucellosis in serological tests. Healthy individuals were chosen from the same geographical areas of the patients.

The Ethical Committee of Hamadan University of Medical Sciences evaluated and approved the investigation and written informed consent was obtained from all participants (Ethical committee ID: IR.UMSHA.REC.1396. 157).

DNA isolation and cytokine genotyping

Genomic DNA was extracted from blood samples by blood DNA extraction kit (Sina- Clon, Iran) according to the manufacturer’s protocol. The IL-12 (+ 1188 A/C) and TNF-α (− 238 A/G) genotyping was carried out by amplification refractory mutation system polymerase chain reaction method (ARMS-PCR) technique.

The primers used in the PCR reaction for IL-12 included common primer 5’ATCTTGGAGCGAATG GGC at 3′, C allele primer 5’TTGTTTCAATGAGCATTTAGCATCT 3’and A allele primer 5’TTG TTTCAATGAGCATTTAGCATCG 3′. The thermocycling conditions for IL-12 included a primary denaturation step at 94 °C for 3 min followed by 35 cycles at 94 °C for 30 s, annealing temperatures at 65 °C for 45 s, extension at 72 °C for 45 s and a final extension step in 72 °C for 5 min. The PCR products for IL-12 were 784 bp.

The primers used in the PCR reaction for TNF-α (− 238 A/G) included common primer 5’CCGGATCATGCTTTCAGTGC 3′, G allele primer 5’AGACCCCCCTCGGAATCG 3′, and A allele primer 5’AAGACCCCCCTCGGAATCA 3′. The forward and reverse primers for internal control (B2-microglobulin gene) were 5’CCAAAGATTCAGGTTTACTCACG 3′, and 5’ACTTAACTATCTTGGGCTGTGAC3′ respectively with cycling conditions of 95 °C 4 min, followed by initial DNA denaturation at 95 °C for 4 min, then 25 cycles of denaturation at 95 °C for 20 s, annealing temperature for TNF-α (− 238 A/G) and B2-microglobulin gene at 58 °C and 66 °C respectively for 50 s and extension at 72 °C for 50 s, followed by the final extension at 72 °C for 10 min. The PCR products for TNF-α and B2-microglobulin were 590 bp and 266 bp respectively [25, 26].

The IL-13 (−1512A/C) and IL-13 (−1112C/T) SNPs were analyzed by the polymerase chain reaction-restricted fragment length polymorphism (PCR-RFLP) method.

For IL-13 (−1512A/C), the primers were 5’CAACCGCCGCGCCAGCGCCTTCTC 3′ and 5’CCGCTA CTTGGCCGTGTGACCGC 3′, and the restriction enzyme was BstUI (Fermentase, Lithuania). The A allele yielded 2 bands of 216 and 29 bp and C allele yielded 194, 29, and 22 bp fragments. For IL-13 (_1112C/T), the primers were 5’GGAATCCAGCATGCCTTGTGAGG 3’and 5’GTCGCCTTTTCCTGCTCTTCCCGC 3’and the restriction enzyme was BstUI; the digestion revealed the fragments of 223 and 23 bp for C allele and 246 bp for the T allele.

PCR program for IL-13 (−1512A/C and − 1112C/T) was applied under the following conditions: Initial denaturation at 94 °C, 12 min; followed by 35 cycles of denaturation at 95 °C, 30 s; annealing for 2 min at 65 °C for IL-13 (−1512A/C); 54 °C for IL-13 (−1112C/T) and extension at 72 °C for 40 s followed by a final extension step at 72 °C for 5 min [27]. PCR products were separated on 2% agarose gel contained 0.5 μg/ mL SYBR Safe and photographed under UV light.

Determination of cytokine levels

Three milliliter of peripheral venous blood sample taken from all patients and control groups. The blood samples were centrifuged at 3000 rpm for 7 min; the sera were stored at − 80 °C until assayed.

Serum cytokine levels (IL-12, IL-13, TNF-α) were analyzed by commercially available ELISA kits (Invitrogen- Thermo Fisher Scientific, Vienna, Austria) according to the manufacturer’s instructions.

Statistical analysis

An online program, SNPSTats ( SNPstats) was used to calculate the genotype frequencies, Hardy Weinberg Equilibrium (HWE) and odds ratios. Version 16 of SPSS was used for analysing the data. p value less than 0.05 was considered to be statistically significant.


Table 1 shows the genotype and alleles of study participants. IL-13 (− 1512 A/C) was associated with brucellosis risk in dominant model (OR (95% CI) = 2.17 (1.02–4.62)), P = 0.041). Allele and genotype frequencies of IL12 (+ 1188 A/C), IL-13 (− 1112 C/T), IL-13 (− 1512 A/C) and TNF-α (− 238 G/A) were not significantly different between patients and controls. The serum levels of IL-12, TNF-α and IL-13 in patients with brucellosis and in controls are shown in Table 2.

Table 1 Association analysis of TNF-α, IL-12 and IL-13 gene polymorphisms and brucellosis
Table 2 Serum levels of TNF-α, IL-12 and IL-13 in patients with brucellosis and controls

Serum level of IL-12 were 4.39 ± 4.77 pg/ml and 2.68 ± 2.02 in brucellosis and control groups, respectively, which shown a significant difference (p < 0.001). The mean serum TNF-α level of patients with brucellosis (15.20 ± 60.37 pg/ml) compared with the controls groups (1.34 ± 1.41 pg/ml). This difference was statistically significant (p < 0.001). Serum levels of IL-13 were (4.23 ± 13.95, 2.30 ± 1.62) pg/ml in brucellosis and controls, respectively. As shown in Table 3, no significant associations were found between serum levels of IL-13, TNF-α and IL-12 and gene polymorphisms [TNF-α (− 238 G/A), IL-12 (+ 1188 A/C), IL-13 (− 1112C/T) and IL-13 (−1512A/C)] in patients with brucellosis and controls. The AA, AC and CC genotype at positions IL-13 (−1512A/C) and IL-12 (+ 1188 A/C) showed a higher IL-13 and IL-12 serum levels in the case group than the control group. The AG and GG genotype at position TNF-α (− 238 G/A) demonstrated a higher TNF-α serum level in patient group than the control group. The patient group with IL-13(− 1112 C/T) CC, CT and TT genotypes had higher IL-13 serum level than that of the control group.

Table 3 Serum levels of TNF-α, IL-12 and IL-13 in brucellosis patients and control groups with different genotypes

The results shown that serum levels of IL-13 (−1512A/C), IL-13 (− 1112 C/T), TNF-α (− 238 G/A) and IL-12 (+ 1188 A/C), were higher in all genotypes of patients than in the control group. However, the serum level of TNF-α (− 238 G/A) genotype AG and serum level of IL-12 (+ 1188 A/C) genotypes CC and AC were significantly (p-value < 0.05) higher in patients with control groups (Table 3). Besides, there were significant association of IL-12 (+ 1188 A/C), TNF-α (− 238 G/A) and IL-13 (− 1512A/C) polymorphisms with the serum levels of these cytokines in both patient and healthy groups separately.


Numerous factors including immunity, environment, and genetics affect the susceptibility to infectious diseases. Studies have shown that single nucleotide polymorphism in genes can influence the regulation of immune responses. The aim of this study was to investigate the probable relationship between TNF-α)- 238 G/A), IL-12 (+ 1188 A/C), and IL-13 (− 1512 A/C and -1112 C/T) gene polymorphisms and their serum concentrations and susceptibility to Brucella infection.

Our results showed that there was no significant association between the genotypes or alleles of IL-13 (− 1112 C/T), IL-13 (− 1512 A/C), IL12 (+ 1188 A/C) and TNF-α)- 238 G/A) between patients with brucellosis and the control group, although the dominant model of IL-13 (− 1512 A/C) influence the susceptibility to brucellosis (p value: 0.041). The previous study have reported significant differences between patients with brucellosis and controls in GG/GG genotypes of TNF-α (− 238 G/A,-308 G/A) and G allele of TNF-α (− 238 G/A) locations [28]. According to study by Eskandari-Nasab et al. GG genotype at position (− 308 G/A) was higher in the control group than in the patients and this genotype was a protective factor while GA genotype, A allele, AAG haplotype were a risk factor against developing brucellosis [29]. Caballero et al. from Spain has shown that TNF-a (− 308) polymorphisms influence the susceptibility to brucellosis [15].

Studies on Interleukin 12 shown that the frequencies of IL-12 AA genotype and A allele were higher in controls than in patients [30, 31]. Previous studies suggested that IL-12 (+ 1188) was related to the susceptibility or resistance to brucellosis and tuberculosis [32, 33]. An additional study found no influence of IL-13 polymorphisms on brucellosis infection [34]. Cytokines play a key role in the regulation of the immune responses [35,36,37]. In the present study, patients had significantly elevated serum levels of IL-12 and TNF-α compared to healthy controls. In terms of IL-13 levels, no significant difference was found between patient and control groups. In accordance with our results, Sanaei Dashti et al. observed that TNF-α and IL-12 serum levels were elevated significantly in brucellosis patients compared to the levels in other febrile patients [38]. In addition, the results of Demirdag and colleagues showed that serum level of TNF- α was high in patients than in controls and reported that this cytokines involved in the pathophysiology of brucellosis [39]. Another study reported that serum level of IL-12 in acute and chronic brucellosis patients were significantly higher than control group [40]. In contrast to our study, Ahmed et al. demonstrated serum level of TNF- α was not detectable in all the serum samples collected from patients; while high serum levels of IL-12 in the patient group compared to the control and patients without brucellosis groups was reported [41]. In our study, no significant associations were found between serum levels of IL-13, TNF-α and IL-12 and different genotypes [TNF-α (− 238 G/A), IL-12 (+ 1188 A/C), IL-13 (− 1112C/T and IL-13-1512A/C)] of the brucellosis patients and controls.

We did not find any study of association between polymorphism IL-13 (− 1512 A/C) and infectious diseases in the literature except for brucellosis [34], although the polymorphism of IL-13 (− 1112 C/T) has been shown to be associated with susceptibility to periodontitis [42]. There were no studies about association between serum levels of these cytokines and gene polymorphisms in brucellosis.


The IL-13 gene polymorphism can be used as a biomarker for detecting susceptibility to brucella disease. Further studies with higher sample size in different populations and the effect of response to treatment on cytokine concentrations should be considered.

Availability of data and materials

The datasets used and/or analyzed during the current study available from the corresponding author on reasonable request.



Amplification refractory mutation system


Enzyme-linked immunosorbent assay


Interferon gamma




Polymerase chain reaction


Restricted fragment length polymorphism


Tumor necrosis factor alpha


  1. Corbel MJ. Brucellosis: an overview. Emerg Infect Dis. 1997;3:213–21.

    Article  CAS  Google Scholar 

  2. Arroyo Carrera I, Lopez Rodriguez MJ, Sapina AM, Lopez Lafuente A, Sacristan AR. Probable transmission of brucellosis by breast milk. J Trop Pediatr. 2006;52:380–1.

    Article  Google Scholar 

  3. Kato Y, Masuda G, Itoda I, Imamura A, Ajisawa A, Negishi M. Brucellosis in a returned traveler and his wife: probable person-to-person transmission of Brucella melitensis. J Travel Med. 2007;14:343–5.

    Article  Google Scholar 

  4. Franco MP, Mulder M, Gilman RH, Smits HL. Human brucellosis. Lancet Infect Dis. 2007;7:775–86.

    Article  CAS  Google Scholar 

  5. Young EJ. An overview of human brucellosis. Clin Infect Dis. 1995;21:283–9 quiz 90.

    Article  CAS  Google Scholar 

  6. Acha NP, Szyfres B. Zoonoses and communicable diseases common to man and animals, vol. 1. 3rd ed. Washington D. C.: Pan American Health Organization (PAHO); 2003.

    Google Scholar 

  7. Megid J, Mathias LA, Robles C. Clinical manifestations of brucellosis in domestic animals and humans. Open Vet Sci J. 2010;4:119–26.

    Article  Google Scholar 

  8. Lucero NE, Ayala SM, Escobar GI, Jacob NR. Brucella isolated in humans and animals in Latin America from 1968 to 2006. Epidemiol Infect. 2008;136:496–503.

    Article  CAS  Google Scholar 

  9. Pappas G, Papadimitriou P, Akritidis N, Christou L, Tsianos EV. The new global map of human brucellosis. Lancet Infect Dis. 2006;6:91–9.

    Article  Google Scholar 

  10. Hashemi SH, Keramat F, Ranjbar M, Mamani M, Farzam A, Jamal-Omidi S. Osteoarticular complications of brucellosis in Hamedan, an endemic area in the west of Iran. Int J Infect Dis. 2007;11:496–500.

    Article  Google Scholar 

  11. Karaoglan I, Pehlivan S, Namiduru M, Pehlivan M, Kilincarslan C, Balkan Y, et al. TNF-alpha, TGF-beta, IL-10, IL-6 and IFN-gamma gene polymorphisms as risk factors for brucellosis. New Microbiol. 2009;32:173–8.

    CAS  PubMed  Google Scholar 

  12. Zhan Y, Kelso A, Cheers C. Differential activation of Brucella-reactive CD4+ T cells by Brucella infection or immunization with antigenic extracts. Infect Immun. 1995;63:969–75.

    CAS  PubMed  PubMed Central  Google Scholar 

  13. Huang L-Y, Aliberti J, Leifer CA, Segal DM, Sher A, Golenbock DT, et al. Heat-killed Brucella abortus induces TNF and IL-12p40 by distinct MyD88-dependent pathways: TNF, unlike IL-12p40 secretion, is Toll-like receptor 2 dependent. J Immunol. 2003;171:1441–6.

    Article  CAS  Google Scholar 

  14. Sathiyaseelan J, Goenka R, Parent M, Benson RM, Murphy EA, Fernandes DM, et al. Treatment of Brucella-susceptible mice with IL-12 increases primary and secondary immunity. Cell Immunol. 2006;243:1–9.

    Article  CAS  Google Scholar 

  15. Caballero A, Bravo MJ, Nieto A, Colmenero JD, Alonso A, Martin J. TNFA promoter polymorphism and susceptibility to brucellosis. J Clin Exp Immunol. 2000a;121:480–3.

    Article  CAS  Google Scholar 

  16. Cooper AM, Magram J, Ferrante J, Orme IM. Interleukin 12 (IL-12) is crucial to the development of protective immunity in mice intravenously infected with mycobacterium tuberculosis. J Exp Med. 1997;186:39–45.

    Article  CAS  Google Scholar 

  17. LOH HSIU YIN A. Association studies of genetic polymorphisms found in interleukins 12, 13 and CD14 gene with asthma and allergic diseases 2005.

  18. Bergholdt R, Ghandil P, Johannesen J, Kristiansen O, Kockum I, Luthman H, et al. Genetic and functional evaluation of an interleukin-12 polymorphism (IDDM18) in families with type 1 diabetes. J Med Genet. 2004;41:e39.

    Article  CAS  Google Scholar 

  19. Jang J-P, Cho W-K, Baek I-C, Choi E-J, Shin D-H, Suh B-K, et al. Comprehensive analysis of cytokine gene polymorphisms defines the association of IL-12 gene with ophthalmopthy in Korean children with autoimmune thyroid disease. Mol Cell Endocrinol. 2016;426:43–9.

    Article  CAS  Google Scholar 

  20. Loures MAR, Alves HV, de Moraes AG, Santos TDS, Lara FF, JSF N, et al. Association of TNF, IL12, and IL23 gene polymorphisms and psoriatic arthritis: meta-analysis. Expert Rev Clin Immunol. 2019;15:1–11.

    Article  Google Scholar 

  21. Reichert S, Machulla HK, Klapproth J, Zimmermann U, Reichert Y, Gläser C, et al. Interferon-gamma and interleukin-12 gene polymorphisms and their relation to aggressive and chronic periodontitis and key periodontal pathogens. J Periodontal. 2008;79:1434–43.

    Article  CAS  Google Scholar 

  22. Santos AC, de Moura EL, Ferreira JM, Santos BR, Alves VM, de Farias KF, et al. Meta-analysis of the relationship between TNF-α (− 308G/A) and IL-10 (− 819C/T) gene polymorphisms and susceptibility to dengue. Immunol Investig. 2017;46:201–20.

    Article  CAS  Google Scholar 

  23. Hollegaard M, Bidwell J. Cytokine gene polymorphism in human disease: on-line databases, supplement 3. Genes Immun. 2006;7:269.

    Article  CAS  Google Scholar 

  24. Kazemi S, Saidijam M, Hashemi SH, Karami M, Vaisi-Raygani A, Alikhani MY. Analysis of IL-10 and IL-6 gene polymorphisms and their serum levels in patients with brucellosis: a case control study. Immunol Investig. 2016;45:107–15.

    Article  CAS  Google Scholar 

  25. Sen A, Paine SK, Chowdhury IH, Mondal LK, Mukherjee A, Biswas A, et al. Association of interferon-gamma, interleukin-10, and tumor necrosis factor-alpha gene polymorphisms with occurrence and severity of Eales’ disease. Invest Ophthalmol Vis Sci. 2011;52:171–8.

    Article  CAS  Google Scholar 

  26. Thada S, Ponnana M, Sivangala R, Joshi L, Alasandagutti M, Ansari MS, et al. Polymorphisms of IFN-gamma (+874A/T) and IL-12 (+1188A/C) in tuberculosis patients and their household contacts in Hyderabad, India. Hum Immunol. 2016a;77:559–65.

    Article  CAS  Google Scholar 

  27. Kim HB, Kang MJ, Lee SY, Jin HS, Kim JH, Kim BS, et al. Combined effect of tumour necrosis factor-alpha and interleukin-13 polymorphisms on bronchial hyperresponsiveness in Korean children with asthma. Clin Exp Allergy. 2008;38:774–80.

    Article  CAS  Google Scholar 

  28. Davoudi S, Amirzargar AA, Hajiabdolbaghi M, Rasoolinejad M, Soodbakhsh A, Jafari S, et al. Th-1 cytokines gene polymorphism in human brucellosis. Int J Immunogenet. 2006;33:355–9.

    Article  CAS  Google Scholar 

  29. Eskandari-Nasab E, Moghadampour M, Sepanj-Nia A. TNF-alpha −238, −308, −863 polymorphisms, and brucellosis infection. Hum Immunol. 2016;77:121–5.

    Article  CAS  Google Scholar 

  30. Kamali-Sarvestani E, Rasouli M, Mortazavi H, Gharesi-Fard B. Cytokine gene polymorphisms and susceptibility to cutaneous leishmaniasis in Iranian patients. Cytokine. 2006;35:159–65.

    Article  CAS  Google Scholar 

  31. Rasouli M, Kiany S, Moravej A, Kalani M. Interleukin-12 and tumor necrosis factor-β gene polymorphisms as genetic susceptibility factors for brucellosis in Iranian patients. Iran Red Crescent Med J. 2010;12:266.

    Google Scholar 

  32. Kabiri F, Rajabnia R, Pournajaf A, Gholami M, Bibalan MH, Kassani A, et al. Association between cytokine gene polymorphisms and human susceptibility to brucellosis. Arch Pediatr Infect Dis. 2017;5(3):e57274.

  33. Thada S, Ponnana M, Sivangala R, Joshi L, Alasandagutti M, Ansari MSS, et al. Polymorphisms of IFN-γ (+ 874A/T) and IL-12 (+ 1188A/C) in tuberculosis patients and their household contacts in Hyderabad, India. Hum Immunol. 2016b;77:559–65.

    Article  CAS  Google Scholar 

  34. Sayed-Jalal-Aladin A-M, Rasouli M, Najafipour S, Moravej A, Kalani M, Negahdaripour M. Relation between interleukin-13 gene polymorphisms and susceptibility to brucellosis in Iranian population. Trends Pharmacol Sci. 2016;2:17–24.

    Google Scholar 

  35. Fernandes DM, Jiang X, Jung JH, Baldwin CL. Comparison of T cell cytokines in resistant and susceptible mice infected with virulent Brucella abortus strain 2308. FEMS Immunol Med Microbiol. 1996;16:193–203.

    Article  CAS  Google Scholar 

  36. Jiang X, Baldwin CL. Effects of cytokines on intracellular growth of Brucella abortus. Infect Immun. 1993;61:124–34.

    CAS  PubMed  PubMed Central  Google Scholar 

  37. Zhan Y, Kelso A, Cheers C. Cytokine production in the murine response to brucella infection or immunization with antigenic extracts. Immunol. 1993;80:458.

    CAS  Google Scholar 

  38. Dashti AS, Karimi A, Elyasi B, Shamshiri AR, Shoja SA, Shamshiri M. Cytokine profiles in acute brucellosis, compared with those in other febrile illnesses. Arch Clin Infect Dis. 2017;12(4):e66077.

  39. Demirdag K, Ozden M, Kalkan A, Godekmerdan A, Kilic SS. Serum cytokine levels in patients with acute brucellosis and their relation to the traditional inflammatory markers. FEMS Immunol Med Microbiol. 2003;39:149–53.

    Article  CAS  Google Scholar 

  40. Rezaee MA, Jalili A, Motaharinia Y, Mohsenpour B, Hakhamaneshi M, Rashidi A, et al. Cytokines’ level in acute and chronic brucellosis patients. Horiz Med Sci. 2012;18:115–20.

    Google Scholar 

  41. Ahmed K, Al-Matrouk KA, Martinez G, Oishi K, Rotimi VO, Nagatake T. Increased serum levels of interferon-gamma and interleukin-12 during human brucellosis. Am J Trop Med Hyg. 1999;61:425–7.

    Article  CAS  Google Scholar 

  42. Zhang W, Xu P, Chen Z, Cheng Y, Li X, Mao Q. IL-13 -1112 polymorphism and periodontitis susceptibility: a meta-analysis. BMC Oral Health. 2018;18:21.

    Article  Google Scholar 

Download references


The authors would like to acknowledge Vice-chancellor of Research and Technology, Hamadan University of Medical Sciences, Hamadan, Iran, and microbiology laboratory staffs.


The Vice-chancellor of Research and Technology, Hamadan University of Medical Sciences, Hamadan, Iran supported financially the study (Grant Number: 9604272614). The funding body had no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Author information

Authors and Affiliations



MYA designed and supervised the study. MS and MAH performed data interpretation. SK was responsible for data collection and doing experiments. FK and SHH performed clinical examination and interpreted the results. ARS analyzing the statistical results of the study. AVR interpretation of data. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Mohammad Yousef Alikhani.

Ethics declarations

Ethics approval and consent to participate

The ethics committee of the Hamadan University of Medical Sciences approved the study protocol (Ethical approval code: IR.UMSHA.REC.1396.157). Ethical Review Board approved written consent taken from all the participants.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Kazemi, S., Vaisi-Raygani, A., Keramat, F. et al. Evaluation of the relationship between IL-12, IL-13 and TNF-α gene polymorphisms with the susceptibility to brucellosis: a case control study. BMC Infect Dis 19, 1036 (2019).

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI:


  • Cytokines
  • Polymorphisms
  • Brucellosis
  • Iran