Open Access
Open Peer Review

This article has Open Peer Review reports available.

How does Open Peer Review work?

A simple and rapid approach for screening of SARS-coronavirus genotypes: an evaluation study

  • Grace TY Chung1, 2,
  • Rossa WK Chiu1, 2,
  • Jo LK Cheung3,
  • Yongjie Jin1, 2,
  • Stephen SC Chim1, 2,
  • Paul KS Chan1, 3 and
  • YM Dennis Lo1, 2Email author
BMC Infectious Diseases20055:87

https://doi.org/10.1186/1471-2334-5-87

Received: 08 June 2005

Accepted: 18 October 2005

Published: 18 October 2005

Abstract

Background

The Severe Acute Respiratory Syndrome (SARS) was a newly emerged infectious disease which caused a global epidemic in 2002–2003. Sequence analysis of SARS-coronavirus isolates revealed that specific genotypes predominated at different periods of the epidemic. This information can be used as a footprint for tracing the epidemiology of infections and monitor viral evolution. However, direct sequencing analysis of a large number of clinical samples is cumbersome and time consuming. We present here a simple and rapid assay for the screening of SARS-coronavirus genotypes based on the use of fluorogenic oligonucleotide probes for allelic discrimination.

Methods

Thirty SARS patients were recruited. Allelic discrimination assays were developed based on the use of fluorogenic oligonucleotide probes (TaqMan). Genotyping of the SARS-coronavirus isolates obtained from these patients were carried out by the allelic discrimination assays and confirmed by direct sequencing.

Results

Genotyping based on the allelic discrimination assays were fully concordant with direct sequencing. All of the 30 SARS-coronavirus genotypes studied were characteristic of genotypes previously documented to be associated with the latter part of the epidemic. Seven of the isolates contained a previously reported major deletion but in patients not epidemiologically related to the previously studied cohort.

Conclusion

We have developed a simple and accurate method for the characterization and screening of SARS-coronavirus genotypes. It is a promising tool for the study of epidemiological relationships between documented cases during an outbreak.

Background

The Severe Acute Respiratory Syndrome (SARS) is a recently emerged infectious disease which led to a global epidemic between 2002 and 2003. A novel coronavirus (SARS-CoV) was identified as the causative agent [1]. The genomic sequence of the SARS-CoV was promptly characterized [2, 3]. Thereafter, studies had focused on the early detection of SARS-CoV and the development of diagnostic tools [46]. Systematic analysis of the SARS-CoV sequence information have demonstrated that characteristic viral genotypes predominated at certain periods during the course of the outbreak [710]. Furthermore, characterization of the viral sequences have been shown to be a useful tool for confirming epidemiological associations between infected individuals as suspected from conventional epidemiological investigations [911]. In-depth analysis of the available sequence data on SARS-CoV also revealed that the viral isolates could be readily subclassified into several major genotypes based on nucleotide variations at specific genomic positions [8, 12]. In a large-scale phylogenetic analysis of SARS-CoV sequences [8], a 5-nucleotide motif at the GZ02 [GenBank :AY390556] reference nucleotide residues 17,564, 21,721, 22,222, 23,823, and 27,827 was identified to be most useful for distinguishing the major SARS-CoV genotypes. These major viral genotypes predominated at different periods of the epidemic [8]. Thus, it is evident that viral sequence and molecular epidemiological data provide valuable information and tools for our combat against infectious diseases. However, direct sequencing of viral isolates from a large number of clinical samples is cumbersome and time consuming. Therefore, a rapid system for the characterization and screening of viral genotypes, such as for SARS-CoV, would potentially be useful. In this study, we demonstrate the feasibility of the adoption of allelic discrimination assays based on the use of fluorogenic oligonucleotide probes for the genotyping of SARS-CoV isolates.

Methods

Study population

Viral culture isolates from 30 SARS patients who were admitted to the hospitals of the New Territories East Cluster of Hong Kong during the SARS epidemic were retrieved. The study was approved by the Institutional Review Board. SARS was confirmed in all cases either by positive reverse transcription-polymerase chain reaction (RT-PCR) detection of SARS-CoV RNA in clinical specimens or documented seroconversion.

Genotype analysis by Taqman allelic discrimination assay

We focused on the development of allelic discrimination assays for the five previously described characteristic single nucleotide variations (SNV) [8]. RNA was extracted from viral isolates cultured from SARS patients' clinical specimens using the QIAamp viral RNA mini kit (Qiagen, Valencia, CA, USA), according to manufacturer's instructions. Eleven microliters of the extracted viral RNA was reverse transcribed by Superscript III (Invitrogen, Carlsbad, CA, USA) with random hexamer according to manufacturer's instructions. Genotyping of the five SNVs was determined using TaqMan (Applied Biosystems, Foster City, CA, USA) allelic discrimination assays on an ABI Prism 7900HT sequence detection system (Applied Biosystems). Each assay consisted of two allele-specific minor groove binding probes associated with either, 6-carboxyfluorescein (FAM) or VIC™ as the fluorescent label, for the discrimination of the two respective alleles at each SNV locus. One assay was designed for each of the 5 SNVs. The primer and probe sequences, designed using the Primer Express 2.0 software (Applied Biosystems) are listed in Table 1. The probes were designed such that the discriminatory nucleotide is placed close to the middle portion of the oligonucleotide. The assays were set up according to the manufacturer's instructions (TaqMan Core PCR Kit; Applied Biosystems) in a reaction volume of 25 μL. Each reaction consists of 1X Buffer A, 4 mM MgCl2, 0.2 μM dATP, 0.2 μM dCTP, 0.2 μM dGTP and 0.4 μM dUTP, 900 nM forward and reverse primers, 200 nM of each fluorescent probe, 0.25U UNG, 0.625U Taq polymerase and 0.5 μl of cDNA as template. The thermal profile consists of an initial incubation at 50°C for 2 min, and then a denaturation period at 95°C for 10 min, followed by 40 cycles of denaturation at 92°C for 15 s, and 1 min of combined annealing and extension at 60°C. The genotypes were scored with the SDS2.1 software.
Table 1

Primers and probes

 

Sequence (all sequence starts from the 5' end)

SNV 17564*

 

Forward primer

GACACTGTGAGTGCTTTAGTTTATGACA

Reverse primer

CCTTTGTAGAACATTTTGAAGCATTG

Probes

FAM-AGCTGACTTATCCTTGTGT

 

VIC-AGCTGACTTCTCCTTGTGT

Synthetic template for allele T

GTTGACACTGTGAGTGCTTTAGTTTATGACAATAAGCTAAAAGCACACAAGGATAAGTCAGCTCAATGCTTCAAAATGTTCTACAAAGGTGT

Synthetic template for allele G

GTTGACACTGTGAGTGCTTTAGTTTATGACAATAAGCTAAAAGCACACAAGGAGAAGTCAGCTCAATGCTTCAAAATGTTCTACAAAGGTGT

SNV 21721

 

Forward primer

CCATTTTATTCTAATGTTACAGGGTTTCA

Reverse primer

TTTCTCTGTGGCAGCAAAATAAATAC

Probes

FAM-ATACGTTTGGCAACCCTGTC

 

VIC-ATACGTTTGACAACCCTGTC

Synthetic template for allele G

CTTCCATTTTATTCTAATGTTACAGGGTTTCATACTATTAATCATACGTTTGGCAACCCTGTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATCA

Synthetic template for allele A

CTTCCATTTTATTCTAATGTTACAGGGTTTCATACTATTAATCATACGTTTGACAACCCTGTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATCA

SNV 22222

 

Forward primer

GAGCCATTCTTACAGCCTTTTTA

Reverse primer

GCCAACAAAATAGGCTGCAG

Probes

FAM-TGCTCAAGACACTTGGG-MGB

 

VIC-TGCTCAAGACATTTGGG-MGB

Synthetic template for allele C

GCCATTCTTACAGCCTTTTTACCTGCTCAAGACACTTGGGGCACGTCAGCTGCAGCCTATTTTGTTGGCTATTTAAAGCCAACTACATTTATGCTCAAGTATGATG

Synthetic template for allele T

GCCATTCTTACAGCCTTTTTACCTGCTCAAGACATTTGGGGCACGTCAGCTGCAGCCTATTTTGTTGGCTATTTAAAGCCAACTACATTTATGCTCAAGTATGATG

SNV 23823

 

Forward primer

TCGCTCAAGTCAAACAAATGTACA

Reverse primer

GAGGGTCAGGTAATATTTGTGAAAAATT

Probes

FAM-CCAACTTTGAAATATTTTGG

 

VIC-CAACTTTGAAAGATTTTGG

Synthetic template for allele T

TGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTGAAATATTTTGGTGGTTTTAATTTTTCACAAATATTACCTGACCCTCTAA

Synthetic template for allele G

TGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTGAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCTGACCCTCTAA

SNV 27827

 

Forward primer

TCATTGTTTTGACTTGTATTTCTCTATGC

Reverse primer

CTTCAAGCACATGAGGTTTATTAGATG

Probes

FAM-TTGCATATGCACTGTAGT

 

VIC-TTGCATACGCACTGTAGT

Synthetic template for allele C

TTCTCATTGTTTTGACTTGTATTTCTCTATGCAGTTGCATATGCACTGTAGTACAGCGCTGTGCATCTAATAAACCTCATGTGCTTGAAGATCC

Synthetic template for allele T

TTCTCATTGTTTTGACTTGTATTTCTCTATGCAGTTGCATACGCACTGTAGTACAGCGCTGTGCATCTAATAAACCTCATGTGCTTGAAGATCC

* probes for SNV 17564 are anti-sense sequences

Sequence confirmation by direct sequencing

All viral sequences were confirmed by direct sequencing. RT-PCR was performed to specifically amplify genomic segments of SARS-CoV encompassing each of the 5 SNVs using primers and protocols previously described [7]. The DNA of each amplicon was sequenced by the dideoxy terminator method on an automated DNA sequencer (3100 Genetic Analyzer, Applied Biosystems) based on capillary electrophoresis.

Results and discussion

Taqman allelic discrimination assays for the 5 SNVs were first tested on synthetic templates (Sigma Genosys, Australia) (Table 1) and verified using 2 viral isolates, CUHK-W1 [GenBank :AY278554] and CUHK-Su10 [GenBank :AY282752]. CUHK-W1 is a SARS-CoV isolate with a G:A:C:T:C motif at the GZ02 reference nucleotide residues 17,564, 21,721, 22,222, 23,823, and 27,827, characteristic of SARS-CoV strains isolated before worldwide dissemination of SARS [8, 13]. On the other hand, CUHK-Su10 demonstrates a T:G:T:T:T motif which is characteristic of SARS-CoV strains isolated after global spread was evident. As evident from figure 1, the newly developed allelic discrimination assays were able to differentiate the 2 viral isolates and genotype each SNV correctly (Table 1).
Figure 1

Allelic discrimination plot of CUHK-Su10 and CUHK-W1. Allelic discrimination at each of the 5 studied SNVs described in the text as demonstrated using the synthetic templates and cDNA from CUHK-Su10 and CUHK-W1 Vero cell culture isolates is presented in the successive plots. ( ) synthetic template for the FAM-labeled allele, ( ) synthetic template for the VIC-labeled allele, ( ) CUHK-W1, ( ) CUHK-Su10, ( ) no template control.

Following initial development and optimization, the allelic discrimination assays were used to genotype SARS-CoV in clinical samples. We were able to successfully determine the SARS-CoV genotypes in all 30 samples. Genotypes of virus isolates at the 5 SNV positions are shown in Table 2. SARS-CoV from all but seven cases showed the T:G:T:T:T motif resembling that of the CUHK-Su 10 isolate. For the remaining seven cases, no allelic signal was detected at SNV position 27,827 (Figure 2), leading to a T:G:T:T:/ motif.
Table 2

Genotype of SARS-CoV culture isolates from 30 patients determined by Taqman Allelic Discrimination assays

Case number

Nucleotide positions

 

17,564

21,721

22,222

23,823

27,827

TC01

T

G

T

T

T

TC02

T

G

T

T

T

TC07

T

G

T

T

T

TC10

T

G

T

T

T

TC11

T

G

T

T

T

TC14

T

G

T

T

T

TC19

T

G

T

T

T

TC20

T

G

T

T

T

TC22

T

G

T

T

T

TC26

T

G

T

T

T

TC27

T

G

T

T

T

TC28

T

G

T

T

T

TC29

T

G

T

T

ND

TC30

T

G

T

T

T

TC32

T

G

T

T

ND

TC34

T

G

T

T

T

TC37

T

G

T

T

T

TC38

T

G

T

T

T

TC39

T

G

T

T

T

TC41

T

G

T

T

T

TC42

T

G

T

T

T

TC43

T

G

T

T

T

TC44

T

G

T

T

T

TC45

T

G

T

T

ND

TC46

T

G

T

T

ND

TC48

T

G

T

T

T

TC51

T

G

T

T

ND

TC52

T

G

T

T

T

TC55

T

G

T

T

ND

TC59

T

G

T

T

ND

CUHK-W1 [AY278554]

G

A

C

T

C

CUHK-Su10 [AY282752]

T

G

T

T

T

ND: no allelic signal

Figure 2

Allelic discrimination plot of 30 SARS patients using the allelic discrimination assay on SNV 27827. ( ) synthetic template for FAM-labeled allele, ( ) synthetic template for VIC-labeled allele, ( ) patients with SARS-CoV showing a T nucleotide at SARS-CoV SNV 27827, ( ) patients with SARS-CoV showing no allelic signal at SNV 27827. This SARS-CoV variant was confirmed to contain a 386 nt deletion encompassing SNV 27827, ( ) no template control.

The SARS-CoV genotypes isolated from the 30 patients were also confirmed by direct sequencing. The sequencing results were fully concordant with that based on the allelic discrimination assays at all the 5 SNVs. The seven samples which gave no allelic signal by the allelic discrimination assay at SNV 27,827 showed a shortened amplicon encompassing the region. Direct sequencing of this short amplicon revealed a deletion of 386 nt identical to a SARS-CoV deletion variant previously reported by our group [8, 9]. This deletion variant was first isolated from a discrete cohort of 15 epidemiologically related SARS patients [9]. In the previous cohort of patients, the origin of the deletion variant was traceable to mid-April 2003 in two patients residing in an estate, T, in Hong Kong with subsequent spread predominantly at the North District Hospital, Hong Kong [9]. To further determine if the newly identified cases were epidemiologically related to the original patient cohort, the case histories were reviewed.

The seven patients had fever onset between April 4 to 15, 2003 which predated the disease onset dates of all cases in the original patient cohort. All but one patient presented to hospital A initially for other medical conditions without fever or evidence of chest infection and appeared to have acquired SARS nosocomially during admission. The remaining patient was a resident at Estate T and presented to hospital A with symptoms and signs of chest infection on April 8, 2003 and SARS was subsequently confirmed. Thus, it appeared that we have identified another cohort of patients harboring the SARS-CoV variant with the 386-nt deletion. It is interesting to note that this study provided additional anecdotal evidence pointing to Estate T as a propagation site for the deletion variant. In addition, we were able to trace the emergence of this deletion variant to early April 2003, weeks before the first appearance reported previously [9].

Our study has clearly demonstrated the feasibility of using allelic discrimination assays as a method for genetic characterization of SARS-CoV genotypes in patients. It is particularly useful when there is already extensive sequence information. Direct sequencing is still the gold standard for identifying new sequence variations when new agents of infectious disease continue to emerge and old ones reemerge. Once the variations have been identified, allelic discrimination assay is more efficient and suitable for large-scale population investigations. A recent study illustrated the use of mass spectrometry-based technology in characterizing SARS sequence variations [14]. However, this method requires post-PCR manipulations and the availability of specialized equipment. On the other hand, allelic discrimination assays have been widely used in the study of associations between single nucleotide polymorphisms and diseases such as cancers [15] and rheumatoid arthritis [16]. The validity of the approach for single nucleotide polymorphism genotyping has been previously demonstrated [1719]. Thus, this study further extended the usefulness of allelic discrimination approach based on fluorogenic oligonucleotide probes. The approach provides a rapid and simple means to accurate genotype screening, making it ideal for epidemiological investigations.

Conclusion

We have evaluated a rapid approach for characterizing SARS-CoV genotypes. The assay is simple, easy to perform and reproducible. It can therefore be used as an efficient means to screen for virus genotypes and track the transmission of a particular viral strain in times of epidemics. Incidentally, we identified a previously reported deletion variant of the SARS-CoV in a new cohort of patients and traced the emergence of this variant to an earlier date than previously reported.

List of abbreviations

SARS: 

Severe acute respiratory syndrome

SARS-CoV: 

SARS-coronavirus

RT-PCR: 

reverse transcription-polymerase chain reaction

SNV: 

single nucleotide variation

Declarations

Acknowledgements

The work is supported by the Research Fund for the Control of Infectious Disease (RFCID) from the Health, Welfare and Food Bureau of the Hong Kong Government SAR.

Authors’ Affiliations

(1)
Centre for Emerging Infectious Diseases, The Chinese University of Hong Kong, Prince of Wales Hospital
(2)
Department of Chemical Pathology, The Chinese University of Hong Kong, Prince of Wales Hospital
(3)
Department of Microbiology, The Chinese University of Hong Kong, Prince of Wales Hospital

References

  1. Fouchier RA, Kuiken T, Schutten M, van Amerongen G, van Doornum GJ, van den Hoogen BG, Peiris M, Lim W, Stohr K, Osterhaus AD: Aetiology: Koch's postulates fulfilled for SARS virus. Nature. 2003, 423: 240-10.1038/423240a.View ArticlePubMedGoogle Scholar
  2. Marra MA, Jones SJ, Astell CR, Holt RA, Brooks-Wilson A, Butterfield YS, Khattra J, Asano JK, Barber SA, Chan SY, Cloutier A, Coughlin SM, Freeman D, Girn N, Griffith OL, Leach SR, Mayo M, McDonald H, Montgomery SB, Pandoh PK, Petrescu AS, Robertson AG, Schein JE, Siddiqui A, Smailus DE, Stott JM, Yang GS, Plummer F, Andonov A, Artsob H, Bastien N, Bernard K, Booth TF, Bowness D, Czub M, Drebot M, Fernando L, Flick R, Garbutt M, Gray M, Grolla A, Jones S, Feldmann H, Meyers A, Kabani A, Li Y, Normand S, Stroher U, Tipples GA, Tyler S, Vogrig R, Ward D, Watson B, Brunham RC, Krajden M, Petric M, Skowronski DM, Upton C, Roper RL: The Genome sequence of the SARS-associated coronavirus. Science. 2003, 300: 1399-1404. 10.1126/science.1085953.View ArticlePubMedGoogle Scholar
  3. Rota PA, Oberste MS, Monroe SS, Nix WA, Campagnoli R, Icenogle JP, Penaranda S, Bankamp B, Maher K, Chen MH, Tong S, Tamin A, Lowe L, Frace M, DeRisi JL, Chen Q, Wang D, Erdman DD, Peret TC, Burns C, Ksiazek TG, Rollin PE, Sanchez A, Liffick S, Holloway B, Limor J, McCaustland K, Olsen-Rasmussen M, Fouchier R, Gunther S, Osterhaus AD, Drosten C, Pallansch MA, Anderson LJ, Bellini WJ: Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science. 2003, 300: 1394-1399. 10.1126/science.1085952.View ArticlePubMedGoogle Scholar
  4. Ng EK, Hui DS, Chan KC, Hung EC, Chiu RW, Lee N, Wu A, Chim SS, Tong YK, Sung JJ, Tam JS, Lo YM: Quantitative analysis and prognostic implication of SARS coronavirus RNA in the plasma and serum of patients with severe acute respiratory syndrome. Clin Chem. 2003, 49: 1976-1980. 10.1373/clinchem.2003.024125.View ArticlePubMedGoogle Scholar
  5. Wang B, Potter SJ, Lin Y, Cunningham AL, Dwyer DE, Su Y, Ma X, Hou Y, Saksena NK: Rapid and sensitive detection of severe acute respiratory syndrome coronavirus by rolling circle amplification. J Clin Microbiol. 2005, 43: 2339-2344. 10.1128/JCM.43.5.2339-2344.2005.View ArticlePubMedPubMed CentralGoogle Scholar
  6. Poon LL, Chan KH, Wong OK, Yam WC, Yuen KY, Guan Y, Lo YM, Peiris JS: Early diagnosis of SARS coronavirus infection by real time RT-PCR. J Clin Virol. 2003, 28: 233-238. 10.1016/j.jcv.2003.08.004.View ArticlePubMedGoogle Scholar
  7. Chim SS, Tong YK, Hung EC, Chiu RW, Lo YM: Genomic sequencing of a SARS coronavirus isolate that predated the Metropole Hotel case cluster in Hong Kong. Clin Chem. 2004, 50: 231-233. 10.1373/clinchem.2003.025536.View ArticlePubMedGoogle Scholar
  8. Chinese SMEC: Molecular evolution of the SARS coronavirus during the course of the SARS epidemic in China. Science. 2004, 303: 1666-1669. 10.1126/science.1092002.View ArticleGoogle Scholar
  9. Chiu RW, Chim SS, Tong YK, Fung KS, Chan PK, Zhao GP, Lo YM: Tracing SARS-coronavirus variant with large genomic deletion. Emerg Infect Dis. 2005, 11: 168-170.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Guan Y, Peiris JS, Zheng B, Poon LL, Chan KH, Zeng FY, Chan CW, Chan MN, Chen JD, Chow KY, Hon CC, Hui KH, Li J, Li VY, Wang Y, Leung SW, Yuen KY, Leung FC: Molecular epidemiology of the novel coronavirus that causes severe acute respiratory syndrome. Lancet. 2004, 363: 99-104. 10.1016/S0140-6736(03)15259-2.View ArticlePubMedGoogle Scholar
  11. Chiu RW, Chim SS, Lo YM: Molecular epidemiology of SARS--from Amoy Gardens to Taiwan. N Engl J Med. 2003, 349: 1875-1876. 10.1056/NEJM200311063491923.View ArticlePubMedGoogle Scholar
  12. Ruan YJ, Wei CL, Ee AL, Vega VB, Thoreau H, Su ST, Chia JM, Ng P, Chiu KP, Lim L, Zhang T, Peng CK, Lin EO, Lee NM, Yee SL, Ng LF, Chee RE, Stanton LW, Long PM, Liu ET: Comparative full-length genome sequence analysis of 14 SARS coronavirus isolates and common mutations associated with putative origins of infection. Lancet. 2003, 361: 1779-1785. 10.1016/S0140-6736(03)13414-9.View ArticlePubMedGoogle Scholar
  13. Tsui SK, Chim SS, Lo YM: Coronavirus genomic-sequence variations and the epidemiology of the severe acute respiratory syndrome. N Engl J Med. 2003, 349: 187-188. 10.1056/NEJM200307103490216.View ArticlePubMedGoogle Scholar
  14. Liu J, Lim SL, Ruan Y, Ling AE, Ng LF, Drosten C, Liu ET, Stanton LW, Hibberd ML: SARS Transmission Pattern in Singapore Reassessed by Viral Sequence Variation Analysis. PLoS Med. 2005, 2: e43-10.1371/journal.pmed.0020043.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Hughes DJ, Ginolhac SM, Coupier I, Corbex M, Bressac-de-Paillerets B, Chompret A, Bignon YJ, Uhrhammer N, Lasset C, Giraud S, Hardouin A, Berthet P, Peyrat JP, Fournier J, Nogues C, Lidereau R, Muller D, Fricker JP, Longy M, Toulas C, Guimbaud R, Maugard C, Olschwang S, Yannoukakos D, Durocher F, Moisan AM, Simard J, Mazoyer S, Lynch HT, Szabo C, Lenoir GM, Goldgar DE, Stoppa-Lyonnet D, Sinilnikova OM: Common BRCA2 variants and modification of breast and ovarian cancer risk in BRCA1 mutation carriers. Cancer Epidemiol Biomarkers Prev. 2005, 14: 265-267.PubMedGoogle Scholar
  16. Kilding R, Akil M, Till S, Amos R, Winfield J, Iles MM, Wilson AG: A biologically important single nucleotide polymorphism within the toll-like receptor-4 gene is not associated with rheumatoid arthritis. Clin Exp Rheumatol. 2003, 21: 340-342.PubMedGoogle Scholar
  17. Letellier C, Kerkhofs P: Real-time PCR for simultaneous detection and genotyping of bovine viral diarrhea virus. J Virol Methods. 2003, 114: 21-27. 10.1016/j.jviromet.2003.08.004.View ArticlePubMedGoogle Scholar
  18. Campsall PA, Au NH, Prendiville JS, Speert DP, Tan R, Thomas EE: Detection and genotyping of varicella-zoster virus by TaqMan allelic discrimination real-time PCR. J Clin Microbiol. 2004, 42: 1409-1413. 10.1128/JCM.42.4.1409-1413.2004.View ArticlePubMedPubMed CentralGoogle Scholar
  19. Namvar L, Olofsson S, Bergstrom T, Lindh M: Detection and typing of Herpes Simplex virus (HSV) in mucocutaneous samples by TaqMan PCR targeting a gB segment homologous for HSV types 1 and 2. J Clin Microbiol. 2005, 43: 2058-2064. 10.1128/JCM.43.5.2058-2064.2005.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Pre-publication history

    1. The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/5/87/prepub

Copyright

© Chung et al; licensee BioMed Central Ltd. 2005

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.