Skip to main content

Table 1 Primers and probes

From: A simple and rapid approach for screening of SARS-coronavirus genotypes: an evaluation study

  Sequence (all sequence starts from the 5' end)
SNV 17564*  
Forward primer GACACTGTGAGTGCTTTAGTTTATGACA
Reverse primer CCTTTGTAGAACATTTTGAAGCATTG
Probes FAM-AGCTGACTTATCCTTGTGT
  VIC-AGCTGACTTCTCCTTGTGT
Synthetic template for allele T GTTGACACTGTGAGTGCTTTAGTTTATGACAATAAGCTAAAAGCACACAAGGATAAGTCAGCTCAATGCTTCAAAATGTTCTACAAAGGTGT
Synthetic template for allele G GTTGACACTGTGAGTGCTTTAGTTTATGACAATAAGCTAAAAGCACACAAGGAGAAGTCAGCTCAATGCTTCAAAATGTTCTACAAAGGTGT
SNV 21721  
Forward primer CCATTTTATTCTAATGTTACAGGGTTTCA
Reverse primer TTTCTCTGTGGCAGCAAAATAAATAC
Probes FAM-ATACGTTTGGCAACCCTGTC
  VIC-ATACGTTTGACAACCCTGTC
Synthetic template for allele G CTTCCATTTTATTCTAATGTTACAGGGTTTCATACTATTAATCATACGTTTGGCAACCCTGTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATCA
Synthetic template for allele A CTTCCATTTTATTCTAATGTTACAGGGTTTCATACTATTAATCATACGTTTGACAACCCTGTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATCA
SNV 22222  
Forward primer GAGCCATTCTTACAGCCTTTTTA
Reverse primer GCCAACAAAATAGGCTGCAG
Probes FAM-TGCTCAAGACACTTGGG-MGB
  VIC-TGCTCAAGACATTTGGG-MGB
Synthetic template for allele C GCCATTCTTACAGCCTTTTTACCTGCTCAAGACACTTGGGGCACGTCAGCTGCAGCCTATTTTGTTGGCTATTTAAAGCCAACTACATTTATGCTCAAGTATGATG
Synthetic template for allele T GCCATTCTTACAGCCTTTTTACCTGCTCAAGACATTTGGGGCACGTCAGCTGCAGCCTATTTTGTTGGCTATTTAAAGCCAACTACATTTATGCTCAAGTATGATG
SNV 23823  
Forward primer TCGCTCAAGTCAAACAAATGTACA
Reverse primer GAGGGTCAGGTAATATTTGTGAAAAATT
Probes FAM-CCAACTTTGAAATATTTTGG
  VIC-CAACTTTGAAAGATTTTGG
Synthetic template for allele T TGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTGAAATATTTTGGTGGTTTTAATTTTTCACAAATATTACCTGACCCTCTAA
Synthetic template for allele G TGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTGAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCTGACCCTCTAA
SNV 27827  
Forward primer TCATTGTTTTGACTTGTATTTCTCTATGC
Reverse primer CTTCAAGCACATGAGGTTTATTAGATG
Probes FAM-TTGCATATGCACTGTAGT
  VIC-TTGCATACGCACTGTAGT
Synthetic template for allele C TTCTCATTGTTTTGACTTGTATTTCTCTATGCAGTTGCATATGCACTGTAGTACAGCGCTGTGCATCTAATAAACCTCATGTGCTTGAAGATCC
Synthetic template for allele T TTCTCATTGTTTTGACTTGTATTTCTCTATGCAGTTGCATACGCACTGTAGTACAGCGCTGTGCATCTAATAAACCTCATGTGCTTGAAGATCC
  1. * probes for SNV 17564 are anti-sense sequences