Fever of unknown origin revealing testicular nocardiosis: a case report and literature review

Abstract

Background

Nocardia is an ubiquitous soil organism. As an opportunistic pathogen, inhalation and skin inoculation are the most common routes of infection. Lungs and skin are the most frequent sites of nocardiosis. Testis is a highly unusual location for nocardiosis.

Case presentation

We report the case of an immunocompromised 75-year-old-man admitted for fever of unknown origin. He presented with skin lesions after gardening and was first suspected of Mediterranean spotted fever, but he did not respond to doxycycline. Then, physical examination revealed new left scrotal swelling that was compatible with a diagnosis of epididymo-orchitis. The patient’s condition did not improve despite empirical antibiotic treatment with the onset of necrotic scrotal abscesses requiring surgery. Nocardia brasiliensis yielded from the removed testis culture. High-dose trimethoprim-sulfamethoxazole and ceftriaxone were started. Multiple micro-abscesses were found in the brain and spinal cord on imaging studies. After 6 weeks of dual antibiotic therapy for disseminated nocardiosis, slight regression of the brain abscesses was observed. The patient was discharged after a 6-month course of antibiotics and remained relapse-free at that time of writing these lines. Trimethoprim-sulfamethoxazole alone is meant to be pursued for 6 months thereafter. We undertook a literature review on previously reported cases of genitourinary and urological nocardiosis; to date, only 36 cases have been published with predominately involvement of kidney, prostate and testis.

Conclusions

To the best of our knowledge, this is the first case of Nocardia brasiliensis simultaneously infecting skin, testis, brain and spinal cord in an immunocompromised patient. Knowledge on uncommon forms of nocardiosis remains scarce. This case report highlights the difficulty of diagnosing atypical nocardiosis and the importance of prompt bacteriological sampling in case of empirical antibiotics failure.

Background

Members of the genus Nocardia are aerobic, Gram-positive, beaded, and partially acid-fast bacilli with the microscopic appearance of branching hyphae, belonging to the Corynebacterineae suborder. They are ubiquitous soil organisms. As an opportunistic pathogen, inhalation and skin inoculation are the most common routes of infection. Lungs and skin are the most frequent sites of nocardiosis. Testis is a highly unusual location for nocardiosis. We herein report the case of an immunocompromised patient with fever of unknown origin unmasking disseminated nocardiosis involving testis, brain and spinal cord. We have included a literature review on previous case reports of genitourinary and urological nocardiosis.

Case presentation

A 75-year-old man was admitted for fever of unknown origin. He had previously been diagnosed with polymyalgia rheumatica, for which a treatment with methylprednisolone 16 mg once a day (OD) was begun 4 months before admission. Methotrexate 10 mg weekly had been introduced 2 months before his admission. He had a past history of acquired amegacaryocytic thrombocytopenia that had been treated with cyclosporin more than 10 years ago.

After his two-month vacation in South of France, where he had been gardening without wearing gloves, he developed a fever above 39 °C with complaints of sore throat. Amoxicillin-clavulanic acid was started after the patient was seen in the emergency room of another hospital.

As the fever persisted, he presented to the emergency room of our institution. An atypical papular skin rash with a necrotic lesion on the back of the left hand, combined with his recent vacation location, prompted an initial suspicion of Mediterranean spotted fever (Fig. 1).

Fig. 1

Skin necrotic lesion on the back of the hand

Therefore, doxycycline 100 mg BID was introduced as an empirical treatment. Antibiotics were continued for 7 days. Meanwhile, a first serologic test for Rickettsia conorii turned negative. Fever and malaise persisted for more than two weeks in total and, after a week of ineffective doxycycline, antibiotics were discontinued.

After 2 weeks of pyrexia, the patient was hospitalized in our internal medicine department. He initially complained primarily about fatigue. He had no arthralgia. Nobody close to him was sick and there was no history of animal exposure. On admission, his vital signs were as follows: body temperature 37,8 °C; pulse rate 66/min; and blood pressure 110/60 mmHg. A physical examination revealed virtual disappearance of the skin lesions and a new aortic heart murmur. First-line laboratory analyses showed an elevation of the C-reactive protein level (CRP) at 45,0 mg/L (normal value < 5,0 mg/L). Transesophageal echocardiography did not show any evidence of infective endocarditis. A chest, abdomen and brain computed tomography (CT) was unremarkable. Methotrexate was discontinued on admission.

No obvious sign of vasculitis was noted on CT brain angiography. Serologic testing for Brucella, Rickettsia conorii and R. mooseri, Coxiella burnetii, Bartonella henselae, Borrelia burgdorferi, Treponema pallidum and human immunodeficiency virus proved negative. Cytomegalovirus and Epstein-Barr virus serologies were compatible with past infection. Rheumatoid factor and antinuclear antibodies turned negative. Repeated blood cultures remained sterile even after prolonged incubation of 7 days.

After 3 weeks of unexplained intermittent pyrexia, the patient was diagnosed with fever of unknown origin. Then, he mentioned a new scrotal swelling and left epididymo-orchitis was confirmed by ultrasound. Urinalysis was normal with no pyuria. Levofloxacin 500 mg OD was started empirically. In spite of a decrease in pain, swelling and CRP level, testis induration persisted. Scrotal abscesses appeared after one week of antibiotic therapy and despite increased levofloxacin doses, they evolved to necrosis. Left orchiectomy was performed. Clindamycin 600 mg TDS and ceftriaxone 2 g OD were started empirically. The dose of methylprednisolone was progressively reduced to a nadir of 2 mg OD.

Nocardia brasiliensis yielded from the testicular biopsy culture. High dose intravenous trimethoprim-sulfamethoxazole (TMP-SMX) (20 mg TMP/kg/day) was started on the 20th day of hospitalization. Ceftriaxone was increased to 2 g BID to treat potential brain involvement. Gadolinium contrast-enhanced magnetic resonance imaging (MRI) of the brain subsequently revealed multiple micro-abscesses mostly in the nucleus nuclei, dura-mater enhancement in the spinal bulb and ventriculitis (Fig. 2). Spinal cord MRI showed a “ring-enhancement” in right posterolateral area of the spinal cord in D12-L1, which was consistent with a 2 mm-abscess (Fig. 3).

Fig. 2

MRI of brain T1 (+ gadolinium) sequence, showing multiple micro-abscesses (hyperintensities pointed by the arrows)

Fig. 3

MRI of spinal cord T1 (+ gadolinium) sequence, showing a 2-mm abscess with a “ring enhancement” in right posterolateral area of the spinal cord in D12-L1 (arrow)

A F-18 fluorodeoxyglucose positron emission tomography/CT was performed to assess the extent of invasive nocardiosis but was unremarkable.

Multi-susceptibility was confirmed and dual parenteral antibiotic therapy with TMP-SMX and ceftriaxone was pursued for 6 weeks.

Histopathologically, signs of inflammation were observed in the testicular biopsy, as well as filamentous branching bacilli. Direct Gram staining showed the typical gram-positive, beaded, filamentous bacilli (Fig. 4).

Fig. 4

Microscopic image of a gram-stained smear of N. brasiliensis from testicular biopsy, demonstrating the typical gram-positive filamentous bacilli. Magnification, x1000

The colonies displayed also partial acid-fastness with the modified form of auramine-rhodamine stain (Fig. 5).

Fig. 5

Microscopic image of auramine-rhodamine modified stained smear of N. brasiliensis from testicular biopsy. Magnification, x1000

After 72 h incubation in 5% CO₂ at 37 °C on sheep blood agar, colonies grew, appearing as chalky white cotton balls because of the presence of abundant aerial filaments (Fig. 6).

Fig. 6

Colonies of N. brasiliensis grown on blood agar plate

Nocardia brasiliensis was identified by matrix-associated laser desorption ionization-time of flight mass spectrometry (MALDI-TOF Biotyper Sirius IVD version 4.2.100; Bruker Daltonics, Bremen, Germany) with a reliable score value (2.06). To confirm the germ identification, 16S rRNA gene sequencing using universal primers (27F: 5’AGAGTTTGATCMTGGCTCAG3’ and 1492R: 5’TACGGYTACCTTGTTACGACTT3’; NF1: 5’TWACACATGCAAGTCGARCG3’ and NF2: 5’CCAACATCTCACGACACGAG3’) was performed on cultured colonies. Its yielded sequence (1025 bp) had 99.90% homology with N. brasiliensis strain DSM AUSMDU00024985 (GenBank accession no.: CP046171.1) by using the NCBI database and the EZBiocloud.

The antimicrobial susceptibility testing was performed by minimum inhibitory concentration (MIC) using E-test gradient strips (BioMérieux, Marcy l’Etoile, France) and interpreted following Clinical and Laboratory Standards Institute (CLSI) M62-ED1:2018 guidelines for Nocardia (Table 1).

Table 1 Antimicrobial susceptibility of patient’s clinical isolate N. brasiliensis

Outcome

Clinical evolution was marked by a slow improvement of the patient’s general condition. Fever gradually decreased in intensity and frequency. Control brain and spinal cord MRI’s were obtained shortly before the end of the 6 weeks of parenteral bitherapy (Figs. 7 and 8): a slight regression of the brain micro-abscesses was observed, and they appeared to be less enhanced by gadolinium, while the spinal cord lesion remained stable.

Fig. 7

RMI of brain T1 (+ gadolinium) sequence, performed after 6 weeks of antibiotics, showing slight regression of the abscesses

Fig. 8

RMI of spinal cord T1(+ gadolinium) sequence, performed after 6 weeks of antibiotics, showing a stable abscess (arrow)

High dose TMP-SMX was then switched from parenteral to oral route and pursued as a monotherapy. At the time of writing these lines, the patient has just been discharged from the rehabilitation department after almost 6 months of treatment. Another control brain MRI showed further reduction of the abscesses. Clinically, the patient still has some walking impairment that requires physiotherapy, with slow but constant improvement. TMP-SMX is meant to be pursued for 6 months thereafter.

Discussion

Nocardiosis most commonly affects immunocompromised patients but may occur in immunocompetent hosts [1,2,3,4]. Disseminated nocardiosis is defined as the involvement of at least two non-contiguous organs and/or demonstration of bloodstream infection [1, 2, 4, 5]. The most frequently infected sites are the lungs, brain and skin [3, 6, 7]. Fever at presentation is inconstant [1,2,3,4]. Diagnosing nocardiosis only by skin inspection is difficult because Nocardia lesions are not specific. They may appear as papules, pustules, nodules and skin infiltration [1, 5, 6]. In our case, with the patient’s epidemiological context, the skin lesions were considered suspicious of a rickettsial disease at the time of presentation. Nocardia skin inoculation while gardening seems to be the pathway to infection in our patient.

Nocardia infects the central nervous system (CNS) in one-third of all cases and it usually manifests as brain abscess while meningitis is rare [5, 8]. Multiple abscesses are seen in 50–80% of the patients [6]. It has been very rarely reported with N. brasiliensis. Patients sometimes present with headache, nausea, vomiting, seizure or alteration in consciousness [1, 7]. CNS invasion may nevertheless be asymptomatic and missing the diagnosis of CNS nocardiosis may cause treatment delay and failure. It has been suggested to perform systematic brain MRI to all patients with a diagnosis of nocardiosis [5, 6]. In our case, lumbar puncture was discussed but not performed because of thrombocytopenia (less than 50 000 platelets/µL), reactions to previous platelet transfusions and clinical improvement with antibiotics. Besides, Nocardia is only exceptionally identified in cerebral spinal fluid culture [8]. Although invasive nocardiosis is generally considered to occur through hematogenous dissemination, identifying Nocardia species on blood culture is very uncommon [2, 5].

Infections of the urinary and urological systems are usually caused by species of the family Enterobacteriaceae; Nocardia infection is extremely rare [4, 8, 9]. We searched PubMed for English-language reports of genitourinary and urological nocardiosis from 1970 to 2022. We found 36 complete cases previously published in the literature [9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41] (Table 2). All except four cases (nr 17, 27, 29 and 31) involved immunocompromised hosts, mostly transplant patients and patients on corticosteroids. Kidneys, prostate and testes were the most commonly infected organs. N. asteroides was the most frequent pathogen. Implication of N. brasiliensis causing urological and genitourinary infection seems rarer but all cases reported skin involvement. It has been described that this strain is more prevalent in cutaneous infections [1, 9]. In our case, N. brasiliensis is thought to have spread hematogenously from the skin to testicular, cerebral and spinal cord sites.

Table 2 Cases of genitourinary and urological nocardiosis reported in the literature

The diagnosis of nocardiosis requires the identification of Nocardia in a bacteriological sample. Nocardia can be isolated by culture from different samples such as sputum, bronchoalveolar lavage fluid, abscess fluid and blood [4, 7]. Because of the slow-growing nature of Nocardia, isolates can take up to 2 weeks to grow on routine culture media used in clinical laboratories, making them difficult to identify [7]. Nevertheless, identification of Nocardia species is important because antimicrobial susceptibility varies among species [1, 2, 4,5,6,7].

Optimal management for nocardiosis has not been established because of the lack of comparative controlled studies, due to the rarity of the cases. TMP-SMX remains the first-choice agent due to good responses as observed since 1950s and because of its good penetration in the CNS [1, 5, 6]. The main adverse reactions to high-dose TMP-SMX therapy are myelosuppression, hepatotoxicity, renal insufficiency and allergic reaction. Linezolid is a good alternative for disseminated and CNS nocardiosis, but its toxicity includes a high risk of myelosuppression and peripheral neuropathy [1]. Initial multidrug therapy is recommended for most forms of nocardiosis (except limited skin infection). Therapeutic changes should be based on initial therapy, susceptibility results and individual specificities. Treatment duration is generally extended to minimize the risk of disease relapse [6]. Nocardia infections may recur because of the slow replication of the pathogen and its intracellular presence [7]. Immunodeficient hosts and/or patients with CNS nocardiosis should receive at least 12 months of antimicrobial therapy (initially intravenous therapy for 4–6 weeks followed by oral agent for 6–12 months) [1, 6, 38]. Neurosurgical drainage should be considered in case of large brain abscess not responding to antimicrobial therapy. Patients with surgical and antibiotics therapy had lower mortality [6].

Conclusion

To the best of our knowledge, this is the first case of N. brasiliensis simultaneously infecting skin, testis, brain and spinal cord in an immunocompromised patient. Our case highlights the difficulty of nocardiosis diagnosis due to complex clinical manifestations. Even though pulmonary, neurological and dermatological involvement are commonly described, the two latter forms may have, as in our patient, tricky clinical presentations and the disease may spread to virtually any organ such as testis.

Knowledge on atypical forms of nocardiosis remains scarce. With our case, we aim to both raise clinician’s awareness and add our experience to the handful of cases described in the literature.