Skip to main content
Download PDF
  • Research article
  • Open access
  • Published:

Magnitude of Rotavirus A and Campylobacter jejuni infections in children with diarrhea in Twin cities of Rawalpindi and Islamabad, Pakistan

BMC Infectious Diseases volume 19, Article number: 978 (2019) Cite this article

Abstract

Background

Acute diarrhea is a leading cause of morbidity and mortality in children particularly in developing countries of Asia and Africa. The present study was conducted to detect the two most important pathogens, rotavirus and Campylobacter Jejuni in children suffering with diarrhea in Rawalpindi and Islamabad, Pakistan in 2014. The clinical and epidemiological aspects of the disease were also investigated.

Methods

A total of 500 stool samples were collected from children presented with clinical signs and symptoms of acute diarrhea. The samples were initially screened for the presence of rotavirus A (RVA) via ELISA (Enzyme-linked immunosorbent assay) and RT-PCR (Reverse Transcriptase PCR) and then were analysed for C. jejuni by using species specific PCR assay.

Results

The detection rate of RVA was 26.4% (132/500) while, Campylobacter was detected in 52% (260/500) of samples with C. jejuni accounted for 48.2% (241/500) of all study cases. Co-infection of C. jejuni with RVA was identified in 21.8% of all cases. Children with RVA and C. jejuni co-infection showed a higher probability (p = 0.01) to be dehydrated. A significant association (p = 0.02) was found between C. jejuni positive status and fever in children. The median age of children with both RVA and C. jejuni infection was 6–11 months. The RVA detection rate was high in winter months of the year while, C. jejuni infections were documented high in summer over 1 year study period.

Conclusions

The overall results have demonstrated the high prevalence of C. jejuni in Rawalpindi, Islamabad, Pakistan in 2014. The results of present study will not only help to calculate disease burden caused by C. jejuni and rotavirus but also will provide critical information to health authorities in planning public health care strategies against these pathogens.

Peer Review reports

Background

Childhood diarrhea is defined as the passage of three or more abnormally watery stools within 24 h [1]. Globally, diarrheal diseases ranked as the second leading cause of death in infants and young children, contributed 2.5 million deaths annually [2]. The developing countries have the highest disease burden caused by diarrhea with almost four fifths of all under five deaths occur in Sub-Saharan Africa and South Asia [3]. According to an estimate by WHO (World health organization) in 2016, the under-five mortality rate in low-income countries was 73.2 deaths per 1000 live births which in nearly 14 times the average rate in developed countries [4]. Diverse parasitic, bacterial and viral agents are involved in diarrheal disease [5, 6]. Although, every diarrheal pathogen can cause disease alone, but 2 or more pathogens can also be responsible for the incidence of diarrhea, referred to as co-infections [7, 8]. Infections caused by RVA and Campylobacter can be of varying degrees from very mild to very severe resulting in complications [9].

Campylobacter is one of the four common causes of bacterial gastroenteritis both in developed and developing countries [10]. Campylobacter species are fastidious Gram negative, non-spore forming bacteria [11]. Campylobacter jejuni is the most prevalent species of genus Campylobacter being major cause of bacterial gastroenteritis worldwide [12]. The clinical symptoms range from moderate watery diarrhea to severe inflammatory diarrhea which may lead to complications including Guillain Barre’ Syndrome [13]. In developing countries C. jejuni is responsible for 0.4 episode of diarrhea per child per year [14].

Group A rotaviruses (RVAs) are considered as the leading cause of fatal dehydrating diarrhea in infants and young children causing 215, 000 deaths worldwide [15,16,17]. The genus Rotavirus (family Reoviridae; sub family Sedoreovirinae) is classified into nine recognized species (RVA-RVI) and another proposed species (RVJ) was identified recently in bats in Serbia [18]. In humans rotavirus strains belong to group A are major cause of disease [19]. To date, 36 G and 51 P genotypes have been reported worldwide [20]. The aetiology of RVA diarrhea is well understood globally with other pathogens [21].

Pakistan is one of the five countries with highest morbidity and mortality associated with diarrhea [22]. According to CDC (Centre of disease control) diarrhea is the second leading cause of death in Pakistan [23]. Regrettably, there is a lack of proper health facilities, continuous monitoring programs, proper trainings and advanced research laboratories facilities in Pakistan. The highly populated areas of Pakistan are suffering from poor water quality and bad sanitary conditions [24]. In view of all these circumstances, diarrhoea remains a major public health problem in Pakistani population.

The present study was designed to access and compare the prevalence of rotavirus and Campylobacter Jejuni among children with diarrhoea admitted in two major hospitals of Rawalpindi and Islamabad, Pakistan. The findings of this study will add to the available data on RVA and C. jejuni associated disease burden and epidemiology in Pakistan. Furthermore it will provide critical information to health experts and researchers in planning public health care strategies and will make them consider effect of co-infections in designing antimicrobial drugs in future.

Methods

Consents of study participants

Written permission were taken from the parents/guardians of study participants (children). Ethical approval was taken from the respective ethical committees of Pakistan Institute of Medical Sciences (PIMS), Benazir Bhutto Shaheed Hospital (BBH) and Internal Review Board (IRB) of COMSATS Institute of Information Technology, Islamabad.

Study sites

Rawalpindi and Islamabad are the third most populous metropolitan cities of Pakistan. The high population size (4.5 million) strengthen the epidemiological monitoring of infectious diseases including gastroenteritis. Benazir Bhutto Shaheed Hospital Rawalpindi (BBH) is a public sector tertiary care hospital with heavy influx (2500 daily) of patients visiting hospital in OPDs (Out patient departments). The hospital is located on the main road in the crowded population of the city. Pakistan Institute of Medical Sciences (PIMS) is research oriented health sciences institute. This is a leading institute for training of doctors and other health staff from all over Pakistan. It is the major referral tertiary care hospital of Capital city Islamabad. There are 200 hospitalizations with 9000 cases in OPD/day in this hospital. The main target of the hospital is to provide health facilities not only to the residents of Rawalpindi/Islamabad but to the people of Northern Areas, Azad Jammu and Kashmir, NWFP (North-West Frontier Province) and Northern areas of Punjab.

Study design

This sentinel surveillance study included 500 children of less than 5 years of age hospitalized or received treatment for acute diarrhea in the emergency paediatric ward of two hospitals, BBH (Rawalpindi) and PIMS (Islamabad), Pakistan. The Performa for the present study was designed to record the demographical and clinical characteristics of patients including patients day of onset of diarrhoea, date of admission in hospital, date of the collection of stool samples, body temperature (°C or °F), dehydration status, duration and episodes of the diarrhea per day, episode and duration of the vomiting per day, gender, age (months), weight (kg), height (cm) and residence of the patients.

Sample collection method

Total 500 stool samples were collected between January 2014 to December 2014 in stool collection vials from patients experienced more than 3 watery loose stools in the last 24 h, with illness duration less than 2 weeks. The children were enrolled between 9:00 AM to 2:00 PM from Friday to Saturday in year 2014. Faecal sample were collected from children with acute gastroenteritis in a 30 ml polystyrene faecal container with spoon (Dynarex) and were stored initially in Microbiology and Public health laboratory COMSATS, Islamabad at − 80 °C until further analysis.

Isolation and identification of Campylobacter jejuni

Stool sample was directly streaked onto modified Charcoal Cefoperazone Deoxycholate Agar (CCDA) (Oxoid, Hampshire, England) containing CAT antibiotic supplement (Cefoperazone 8 mg/litter, Amphotericin B 20 mg/litter, Teicoplanin 8 mg/litter) (Oxoid, Hampshire, England) These plates were incubated under microaerophilic conditions (Oxoid Campygen sachets Oxoid, Hampshire) for 48 to 72 h at 42 °C [25]. The isolated colonies were primarily identified on the basis of Gram staining, catalase, hippurate hydrolysis and oxidase activity. For molecular identification, DNA extraction was performed using phenol/chloroform method which was a modified version of Cheng and Jiang [26]. A negative extraction control with PBS and positive control was included in the extraction as well as in each PCR runs in each batch. Species specific primer for the detection of C. jejuni are HipO-F, (GACTTCGTGCAGATATGGATGCTT) and HipO-R, (GCTATAACTATCCGAAGAAGCCATCA) were used [27]. Thermo cycler conditions were 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 52 °C for 45 s and 72 °C for 60s, and finally 72 °C for 10 min. Cj255 was used as positive control [27].

Detection of group a Rotavirus in Faecal samples

The presence of group A rotavirus was initially determined by screening of prepared stool dilutions using commercially available enzyme immunoassay ProSpect™ test. The test was carried out according to manufacturer’s instructions.

RT-PCR for VP7 and VP4 genes

RT-PCR was carried out for VP7 and VP4 gene fragments of 1062 and 876 bp respectively by using consensus primers (Beg9, End9 for VP7; VP41-17F, Con2 for VP4). The primer sequences used are Beg9 (5’GGC TTT AAA AGA GAG AAT TTC CGT CTG G3’), End9 (5’GGT CAC ATC ATA CAA TTC TAA TCT AAG3’). VP4_1-17F (5’GGC TAT AAA ATG GCT TCG C3’) and con2 (5’ATT TCG GAC CAT TTA TAA CC3’) [28, 29]. The extracted RNA template was denatured for 2 min at 95 °C followed by reverse transcriptase PCR (RT-PCR) was carried out by using the Qiagen OneStep RT-PCR Kit (Qiagen/Westburg, The Nederland). The RT-PCR conditions involved initial reverse transcription at (30 min at 50 °C), polymerase activation at (95 °C for 15 min), 40 cycles of amplification (denaturation: 45 s at 94 °C; annealing (45 s at 45 °C for VP4 and 45 s at 50 °C for VP7), product extension (1 min at 72 °C) with final extension (10 min at 72 °C) [30]. The resulting PCR products were run on a polyacrylamide gel, stained with Ethidium Bromide (EtBr, Sigma Aldrich) and visualized under ultra violet light (UV-light).

Statistical analysis

Statistical analyses were performed with SPSS software (v21.0) [31]. A Chi Square test was performed to test the possible difference between gender and RVA and Campylobacter jejuni status. For comparison of RVA and C. jejuni between different age groups, Student T test was performed. Descriptive statistics such as mean, median and standard deviation were calculated for other continuous variables like weight, height, fever, diarrhea duration and diarrhea episode, vomiting duration and vomiting episodes of the study. Statistical significance was defined as p < 0.05.

Results

Prevalence of RVA and campylobacter. Jejuni

A total of 500 stool samples from diarrheic children were analysed for the detection of rotavirus and C. jejuni. The ELISA for RVA was conducted for all stool samples and 132 samples were found to be positive through ELISA. Then, RT-PCR conducted for all ELISA positive samples showed 94.7% (125/132) of these samples were RVA positive by RT-PCR. The results of RT-PCR for RVA are shown in Figs. 1 and 2. Campylobacter was detected in 52% (260/500) of samples, with C. jejuni accounted for 48.2% (241/500) of all study cases. The results of PCR for Campylobacter Jejuni are shown in Fig. 3. The prevalence of rotavirus was found to be 26.4% (132/500) while, coinfection of C. jejuni and RVA was detected in 21.8% (109/500) of study samples. Total 236(47.2%) samples were found negative for both rotavirus and C. jejuni.

Fig. 1
figure 1

Identification of rotavirus A VP4 gene segment by using VP4 1-17F and Con2 primers: Lane 1: Positive control, Lane 2: DNA ladder 50 bp, lane 3, 4, 5, 6, 8, 9, 10, 11: Amplified product of gene segment VP4 (876 bp size) of samples no 1, 2, 3, 4, 6, 7, 12 and 13, Lane7: Samples number 5 negative for VP4 gene, Lane 12: Negative control

Full size image
Fig. 2
figure 2

Identification of rotavirus A VP7 gene segment by using Beg9 and End 9 primers: Lane 1: DNA ladder 50 bp, Lane 2: positive control,:, lane 3, 4, 5, 6, 7, 8, 9, 11: Amplified product of gene segment VP7 (1062 bp size) of samples no 1, 2, 3, 4, 7, 8, 9 and 13, Lane 10: Samples number 10 negative for VP7 gene, Lane 12: Negative control

Full size image
Fig. 3
figure 3

Identification of Campylobacter jejuni using HipO-F and HipO-R primers: lane 1 DNA ladder 100 bp, lane 2 positive control (cj 255), lane 3 to 7 human isolates [1, 3, 4, 12, 15] lane 8 negative control

Full size image

Socio-demographic and clinical characteristics of study population

Rotavirus a

There was a statistically significant association found between gender and RVA gastroenteritis (p = 0.001). The incidence of RVA was higher in males than in females (Table 1). There was a statistically significance association found between mean age and RVA positive status (p = 0.03). However, according to the results of ELISA, highest rates of RVA infections were detected in children of 6–11 months of age and lowest in children > 18 months of age (Fig. 4). A statistically significant association was observed between dehydration and RVA gastroenteritis (p<0.009). However, other demographic and clinical characteristics (weight, height, temperature, diarrhoea duration and episodes, vomiting duration and episodes) had no statistically significant association with RVA gastroenteritis (Table 2).

Table 1 Gender wise distribution of RVA and campylobacter Jejuni infections among children with acute gastroenteritis (AGE) during year 2014
Full size table
Fig. 4
figure 4

Age-wise Distribution of rotavirus A s and Campylobacter Jejuni infections among children with acute gastroenteritis (AGE) in Rawalpindi, Islamabad during year 2014

Full size image
Table 2 Comparison of demographic and clinical features of children with campylobacter Jejuni and RVA positive gastroenteritis during year 2014
Full size table

Campylobacter jejuni

There was a statistically significant association observed between gender and C. jejuni infection (p = 0.004). The prevalence of C. jejuni was higher in males than in females (Table 1). There was no statistically significant relationship between age and C. jejuni positive status (p = 0.18) (Table 2). The detection rates of C. jejuni ranged between 32% among age 0–2 months to about 58% among age 6–11 months (Fig. 4). There was statistically significant association observed between dehydration and C. jejuni positive status (p = 0.02). Significant temperature difference was observed between cases of C. jejuni gastroenteritis and gastroenteritis due to other causes (p = 0.02) (Table 2). However, other demographic and clinical characteristics (weight, height, diarrhoea duration and episodes, vomiting duration and episodes) had no statistically significant association with C. jejuni gastroenteritis (p > 0.05) (Table 2).

RVA and C. jejuni co-infection

There was a significant association observed between gender and RVA-C. jejuni co-infection cases (p = 0.004) (Table 1). There was no statistically significant association found between age and RVA-C. jejuni co-infection cases (p = 0.06). There was significance difference observed between dehydration and RVA-C. jejuni co-infection status (p = 0.01). However, other demographic and clinical characteristics (weight, height, temperature, diarrhoea duration and episodes, vomiting duration and episodes) were statistically not significantly correlated with RVA and C. jejuni Co-infection cases (p > 0.05) (Table 2).

Seasonality

The incidence of RVA and C. jejuni infections was observed throughout the year during 1 year of study period (January–December). However, the highest positive cases of RVA were detected in dry winter months (October to December) of the year 2014. The highest prevalence of C. jejuni infections occurred during summer months of the year 2014 (June to September) (Fig. 5).

Fig. 5
figure 5

Month-wise Screening of human Group A rotavirus and Campylobacter Jejuni samples among children detected with acute gastroenteritis (AGE) in Rawalpindi, Islamabad during year 2014

Full size image

Discussion

Acute gastroenteritis continuous to be a serious health dilemma in both developed and developing countries [10]. According to a recent estimate 36,862 children die every year due to diarrhoea in Pakistan [32]. Pakistan is supported by WHO (World health organization) and its partner GAVI (Global Alliance for Vaccine and Immunization) to control communicable disease burden including diarrhea. However still there is poor state of health care system in Pakistan. Keeping in mind the importance of proper surveillance program in the country we have determined the prevalence of rotavirus and Campylobacter Jejuni in two major hospitals of Rawalpindi, Islamabad, Pakistan during 2014.

In this hospital-based study prevalence of C. jejuni was 48.2% while 26.4% children were infected with Rotavirus A (RVA). The incidence of co-infection was found to be 21.8% in all study samples. The RVA prevalence in the present study is quite similar to the previous reported rate (29–34%) in Pakistan [33,34,35]. Campylobacter contributed highest disease burden of diarrhea in Pakistan during year 2014 which is in accordance with the previous study conducted in Malawi [13]. The prevalence of C. jejuni detected in previous studies conducted in Military hospital in Rawalpindi, Islamabad, Pakistan and Agha Khan Hospital Karachi was lower than the present study [36, 37]. There might be several reasons for this low prevalence, such as a different study design and sampling period, type of health facilities and diagnostic procedures in target hospital and patients age and patient testing standards.

In the present study RVA infection was detected mostly in children of 6–11 months of age. These results are in accordance with previous studies from Pakistan showing majority of children effected with RVA infection are <2 years of age [33, 35, 38, 39] and other countries of the world [40,41,42,43]. The reason of high RVA infection in lower age may be due to low immunity in children of less age.

The prevalence of C. jejuni was found to be highest in the age group 6–11 months similar to RVA. However, the prevalence of RVA in children of > 18 months of age with diarrhea was 10% compared with 50% in C. jejuni in the current study.. Campylobacter, therefore contributed largely to diarrheal infection in children more than 12 months of age. There is a possibility of repeated exposures to Campylobacter species from different sources for the whole childhood period which may elucidating the high prevalence in children > 1 years of age [13]. The mortality rate due to diarrhea is decreasing with increasing age of children however morbidity remain constant in adult population [44].

Rotavirus A infections commonly present during the winter months in temperate climates. However, in most tropical areas RVA causes enteritis throughout the year without seasonal variation [45]. Pakistan is located in the temperate zone (between latitudes 25° and 36° N) with extreme temperature variations. In the present study RVA infection was present throughout the year with increasing frequency of RVA positive cases in winter. The results of present study are similar to previous studies reported in Pakistan with RVA predominance throughout the year [33,34,35, 38]. The same seasonal pattern was reported in Bangladesh, India and Thailand [46,47,48].

The seasonal pattern of Campylobacter infection varies from country to country as well as within a country. In developing countries, Campylobacter enteritis has no seasonal fluctuation while in developed countries its epidemic peaks are in summer and winter [49, 50]. In present study Campylobacter was detected throughout the year with prominent peaks from June to September which is consistent with previous studies from Pakistan and Malawi [13, 36, 51, 52].

There are variations in associations between co-infection and clinical characteristics of study population. Some studies have reported more severe diarrhoea in co-infection cases, while other studies have found no difference between mono-infection and co-infection [7, 53]. Significant association was found between dehydration and co-infection. However, there were no significant association in the severity of diarrhea, vomiting and fever among children with single infection and co-infection.

RVA had significant association with dehydration but not with diarrhea, vomiting and fever. RVA infection contributed more to dehydration in children than Campylobacter. A significant high fever was observed among children with campylobacter infection than RVA. In comparison to frequency of diarrhea and vomiting between rotavirus and campylobacter no significant association was found. The mean height in Campylobacter and RVA positive was seen marginally lower than negative cases. The clinical results of present study are consistent with previous findings from other countries of the world [7, 54].

The short study period, small number of samples and lack of multiple study sites are the major limitations of this study. Therefore, the continued surveillance of pathegens causing diarrhea is mandatory in the country to assess the disease burden which will further help in developing informed disease prevention strategies against these pathogens.

Conclusions

In conclusion, this hospital-based study of children hospitalized with diarrhea in Pakistan suggests the high disease burden of Campylobacter Jejuni in association with rotavirus A infection. RVA vaccine is included recently in the EPI Program of Pakistan as recommended by WHO (World health organization). It is predicted that after the introduction of rotavirus vaccine the bacterial agent including Campylobacter could play a leading role in diarrheal diseases in future. It is empirically important to conduct more studies and improve the existing diagnostic methods into fast less time consuming techniques for rapid diagnosis. Conclusively, further exploration regarding the cost of illness due to unsafe drinking water in the country should allow the government to construct and implement inherently efficient policies and schemes in the future.

Availability of data and materials

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Abbreviations

BBH:

Benazir Bhutto hospital

CDC:

Centre of disease control

CUI:

COMSATS University, Islamabad

ELISA:

Enzyme-linked immunosorbent assay

EPI:

Expanded program on immunization

GAVI:

Global Alliance for Vaccines and Immunisation

IRB:

Internal review board

NWFP:

North-West Frontier Province

OPD:

Outpatient door

PIMS:

Pakistan institute of medical sciences

RT-PCR:

Reverse Transcriptase PCR

SPSS:

Statistical package for the social sciences

WHO:

World health organization

References

  1. Gidudu J, Sack DA, Pina M, Hudson MJ, Kohl KS, Bishop P, et al. Diarrhea: Case definition and guidelines for collection, analysis, and presentation of immunization safety data. Vaccine. 2011;29(5):1053–71 Available from: https://www.sciencedirect.com/science/article/pii/S0264410X10017093?via%3Dihub. [cited 2019 May 3].

    Article  CAS  PubMed  Google Scholar 

  2. Lomazzi M, Borisch B, Laaser U. The Millennium Development Goals: experiences, achievements and what’s next. Glob Health Action. 2014;7(1):23695 Available from: http://www.ncbi.nlm.nih.gov/pubmed/24560268. [cited 2019 May 3].

    Article  PubMed  Google Scholar 

  3. Alebel A, Tesema C, Temesgen B, Gebrie A, Petrucka P, Kibret GD. Prevalence and determinants of diarrhea among under-five children in Ethiopia: A systematic review and meta-analysis. PLoS One. 2018;13(6):e0199684 Available from: https://doi.org/10.1371/journal.pone.0199684. [cited 2019 May 3].

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  4. WHO. WHO. 2019; Available from: https://www.who.int/gho/en/. [cited 2019 May 3]

    Google Scholar 

  5. Rathaur, et al. Clinical study of acute childhood diarrhoea caused by bacterial enteropathogens. J Clin Diagn Res. 2014;8(5):PC01–5.

    PubMed  PubMed Central  Google Scholar 

  6. Bicer S, Col D, Erdag GC, Giray T, Gurol Y, Yilmaz G, et al. A retrospective analysis of acute gastroenteritis agents in children admitted to a university hospital pediatric emergency unit. Jundishapur J Microbiol. 2014;7(4):e9148.

    PubMed  PubMed Central  Google Scholar 

  7. Moyo SJ, Kommedal Ø, Blomberg B, Hanevik K, Tellevik MG, Maselle SY, et al. Comprehensive Analysis of Prevalence, Epidemiologic Characteristics, and Clinical Characteristics of Monoinfection and Coinfection in Diarrheal Diseases in Children in Tanzania. Am J Epidemiol. 2017;186(9):1074–83 Available from: https://academic.oup.com/aje/article/186/9/1074/3852293. [cited 2018 Sep 23].

    Article  PubMed  PubMed Central  Google Scholar 

  8. Platts-Mills JA, Babji S, Bodhidatta L, Gratz J, Haque R, Havt A, et al. Pathogen-specific burdens of community diarrhoea in developing countries: a multisite birth cohort study (MAL-ED). Lancet Glob Heal. 2015;3(9):e564–75 Available from: http://www.ncbi.nlm.nih.gov/pubmed/26202075. [cited 2019 May 12].

    Article  Google Scholar 

  9. Habib MI, Kazi SG, Ahmed Khan KM, Zia N. Rota virus Diarrhea in Hospitalized Children. J Coll Physicians Surg Pak. 2014;24(2):114–7 Available from: http://www.ncbi.nlm.nih.gov/pubmed/24491006. [cited 2017 Sep 25].

    PubMed  Google Scholar 

  10. Li Y, Zhang S, He M, Zhang Y, Fu Y, Liang H, et al. Prevalence and Molecular Characterization of Campylobacter spp. Isolated from Patients with Diarrhea in Shunyi, Beijing. Front Microbiol. 2018;9:52 Available from: http://www.ncbi.nlm.nih.gov/pubmed/29434579. [cited 2018 Sep 23].

    Article  PubMed  PubMed Central  Google Scholar 

  11. Man SM. The clinical importance of emerging Campylobacter species. Nat Rev Gastroenterol Hepatol. 2011;8(12):669–85 Available from: http://www.ncbi.nlm.nih.gov/pubmed/22025030. [cited 2019 May 12].

    Article  CAS  PubMed  Google Scholar 

  12. Lee G, Pan W, Peñ Ataro Yori P, Olortegui MP, Tilley D, Gregory M, et al. Symptomatic and Asymptomatic Campylobacter Infections Associated with Reduced Growth in Peruvian Children. PLoS One. 2013;7(1):e2036 Available from: www.plosntds.org. [cited 2019 May 3].

    Google Scholar 

  13. Mason J, Iturriza-Gomara M, O’Brien SJ, Ngwira BM, Dove W, Maiden MCJ, et al. Campylobacter Infection in Children in Malawi Is Common and Is Frequently Associated with Enteric Virus Co-Infections. Hold GL, editor. PLoS One. 2013;8(3):e59663 Available from: http://dx.plos.org/10.1371/journal.pone.0059663. [cited 2018 Aug 20].

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Shang Y, Ren F, Song Z, Li Q, Zhou X, Wang X, et al. Insights into Campylobacter jejuni colonization and enteritis using a novel infant rabbit model. Sci Rep. 2016;6(1):28737 Available from: http://www.nature.com/articles/srep28737.[cited 2019 May 12].

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Clark A, Black R, Tate J, Roose A, Kotloff K, Lam D, Blackwelder W, Parashar U, Lanata C, TC KG. Estimating global, regional and national rotavirus deaths in children aged< 5 years: current approaches, new analyses and proposed improvements. PLoS One. 2017;12(9):e0183392 Available from: https://doi.org/10.1371/journal.pone.0183392. [cited 2018 Oct 23].

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  16. WHO. 2016. Estimated rotavirus deaths for children under 5 years of age: 2013, 215 000. WHO. 2016; Available from: https://www.who.int/immunization/monitoring_surveillance/burden/estimates/rotavirus/en/. [cited 2018 Oct 24]

  17. Tate JE, Burton AH, Boschi-Pinto C, Parashar UD. Global, Regional, and National Estimates of Rotavirus Mortality in Children <5 Years of Age, 2000–2013. Clin Infect Dis. 2016;62(suppl 2):S96–105 Available from: http://www.ncbi.nlm.nih.gov/pubmed/27059362. [cited 2017 Dec 16];.

    Article  PubMed  Google Scholar 

  18. Mihalov-Kovács E, Gellért Á, Marton S, Farkas SL, Fehér E, Oldal M, et al. Candidate new rotavirus species in sheltered dogs, Hungary. Emerg Infect Dis. 2015;21(4):660–3 Available from: http://www.ncbi.nlm.nih.gov/pubmed/25811414. [cited 2017 Jun 2].

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  19. Zeller M, Donato C, Sequeira Trovã N, Cowley D, Heylen E, Donker NC, et al. Genome-Wide Evolutionary Analyses of G1P[8] Strains Isolated Before and After Rotavirus Vaccine Introduction. Genome Biol Evol. 2015;7(9):2473–83 Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4607516/pdf/evv157.pdf. [cited 2018 Sep 25].

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. RCWG. Rotavirus Classification Working Group: RCWG – Laboratory of Viral Metagenomics 2018. Available from: https://rega.kuleuven.be/cev/viralmetagenomics/virus-classification/rcwg. [cited 2019 Jun 7]

    Google Scholar 

  21. Cunliffe NA, Ngwira BM, Dove W, Thindwa BDM, Turner AM, Broadhead RL, et al. Epidemiology of Rotavirus infection in Children in Blantyre, Malawi, 1997–2007. J Infect Dis. 2010;202(S1):S168–74.

    Article  PubMed  Google Scholar 

  22. Dawn News. Pakistan among top five diarrhoea death victims. 2013

    Google Scholar 

  23. CDC. Global Health - Pakistan. 2017. Available from: https://www.cdc.gov/globalhealth/countries/pakistan/default.htm. [cited 2018 Sep 24]

    Google Scholar 

  24. Health Situation. 2018. Available from: http://apps.who.int/gho/data/node.cco. [cited 2018 Sep 24]

  25. Siddiqui FM, Akram M, Noureen N, Noreen Z, Bokhari H. Antibiotic susceptibility profiling and virulence potential of Campylobacter jejuni isolates from different sources in Pakistan. Asian Pac J Trop Med. 2015;8(3):197–202 Available from: http://linkinghub.elsevier.com/retrieve/pii/S199576451460314X. [cited 2018 Sep 23].

    Article  CAS  PubMed  Google Scholar 

  26. Cheng H-R, Jiang N. Extremely Rapid Extraction of DNA from Bacteria and Yeasts. Biotechnol Lett. 2006;28(1):55–9 Available from: http://www.ncbi.nlm.nih.gov/pubmed/16369876. [cited 2018 Sep 24].

    Article  CAS  PubMed  Google Scholar 

  27. Gómez-Duarte OG, Bai J, Newell E. Detection of Escherichia coli, Salmonella spp., Shigella spp., Yersinia enterocolitica, Vibrio cholerae, and Campylobacter spp. enteropathogens by 3-reaction multiplex polymerase chain reaction. Diagn Microbiol Infect Dis. 2009;63(1):1–9 Available from: http://www.ncbi.nlm.nih.gov/pubmed/18990527. [cited 2018 Sep 24].

    Article  PubMed  CAS  Google Scholar 

  28. Gentsch JR, Glass RI, Woods P, Gouvea V, Gorziglia M, Flores J, et al. Identification of group a rotavirus gene 4 types by polymerase chain reaction. J Clin Microbiol. 1992;30(6):1365–73.

    CAS  PubMed  PubMed Central  Google Scholar 

  29. Gouvea V, Glass RI, Woods P, Taniguchi K, Clark HF, Forrester B, et al. Polymerase chain reaction amplification and typing of rotavirus nucleic acid from stool specimens. J Clin Microbiol. 1990;28(2):276–82.

    CAS  PubMed  PubMed Central  Google Scholar 

  30. Sadiq A, Bostan N, Bokhari H, Matthijnssens J, Yinda KC, Raza S, et al. Molecular characterization of human group A rotavirus genotypes circulating in Rawalpindi, Islamabad, Pakistan during 2015–2016. Lin B, editor. PLoS One. 2019;14(7):e0220387 Available from: http://dx.plos.org/10.1371/journal.pone.0220387. [cited 2019 Aug 1].

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Armonk N, IBM Corp. IBM SPSS Statistics for Windows, Version 21.0: IBM Corp; 2012. Available from: http://www.sciepub.com/reference/116002. [cited 2018 Sep 24].

  32. Diarrhoeal disease . 2018. Available from: https://data.unicef.org/topic/child-health/diarrhoeal-disease/. [cited 2018 Sep 23]

  33. Tamim S, Hasan F, Matthijnssens J, Sharif S, Shaukat S, Alam MM, et al. Epidemiology and phylogenetic analysis of VP7 and VP4 genes of rotaviruses circulating in Rawalpindi, Pakistan during 2010. Infect Genet Evol. 2013;14:161–8 Available from: http://www.ncbi.nlm.nih.gov/pubmed/23187023. [cited 2017 Aug 21].

    Article  CAS  PubMed  Google Scholar 

  34. Alam MM, Khurshid A, Shaukat S, Suleman RM, Sharif S, Angez M, et al. Epidemiology and genetic diversity of Rotavirus strains in Children with acute gastroenteritis in Lahore, Pakistan. PLoS One. 2013;8(6):2–9.

    Google Scholar 

  35. Kazi AM, Warraich GJ, Qureshi S, Qureshi H, Khan MMA, Zaidi AKM, et al. Sentinel Hospital-Based Surveillance for Assessment of Burden of Rotavirus Gastroenteritis in Children in Pakistan. Ali M, editor. PLoS One. 2014;9(10):e108221 Available from: http://dx.plos.org/10.1371/journal.pone.0108221. [cited 2017 Aug 22].

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  36. Soofi SB, Habib MA, von Seidlein L, Khan MJ, Muhammad S, Bhutto N, et al. A comparison of disease caused by Shigella and Campylobacter species: 24 months community based surveillance in 4 slums of Karachi, Pakistan. J Infect Public Health. 2011;4(1):12–21 Available from: https://www.sciencedirect.com/science/article/pii/S1876034110000791. [cited 2018 Sep 23].

    Article  PubMed  Google Scholar 

  37. Ali AM, Qureshi AH, Rafi S, Roshan E, Khan I, Malik AM, Shahid SA. Frequency of Campylobacter Jejuni in Diarrhoea/Dysentery in Children in Rawalpindi and Islamabad. JPMA. 2003;53(11):517 Available from: https://jpma.org.pk/article-details/298. [cited 2019 May 3].

    CAS  Google Scholar 

  38. Umair M, Abbasi BH, Nisar N, Alam MM, Sharif S, Shaukat S, et al. Molecular analysis of group A rotaviruses detected in hospitalized children from Rawalpindi, Pakistan during 2014. Infect Genet Evol. 2017;53:160–6 Available from: http://linkinghub.elsevier.com/retrieve/pii/S1567134817301600. [cited 2017 Aug 21].

    Article  CAS  PubMed  Google Scholar 

  39. Iftikhar T, Butt A, Nawaz K, Sarwar Y, Ali A, Mustafa T, et al. Genotyping of rotaviruses detected in children admitted to hospital from Faisalabad Region, Pakistan. J Med Virol. 2012;84(12):2003–7 Available from: http://www.ncbi.nlm.nih.gov/pubmed/23080509. [cited 2017 Aug 22].

    Article  PubMed  Google Scholar 

  40. Saudy N, Elshabrawy WO, Megahed A, Foad MF, Mohamed AF. Genotyping and Clinicoepidemiological Characterization of Rotavirus Acute Gastroenteritis in Egyptian Children. Polish J Microbiol. 2016;65(4):433–42 Available from: https://pjm-microbiology.publisherspanel.com/gicid/01.3001.0010.8341. [cited 2019 May 12].

    Article  Google Scholar 

  41. Carvalho-Costa FA, de Assis RMS, Fialho AM, Araújo IT, Silva MF, Gómez MM, et al. The evolving epidemiology of rotavirus A infection in Brazil a decade after the introduction of universal vaccination with Rotarix®. BMC Pediatr. 2019;19(1):42 Available from: https://bmcpediatr.biomedcentral.com/articles/10.1186/s12887-019-1415-9. [cited 2019 May 12].

    Article  PubMed  PubMed Central  Google Scholar 

  42. Kargar M, Zare M, Najafi A. Molecular Epidemiology of Rotavirus Strains Circulating among Children with Gastroenteritis in Iran. Iran J Pediatr. 2012;22(1):63–9 Available from: http://www.ncbi.nlm.nih.gov/pubmed/23056861. [cited 2019 May 12].

    PubMed  PubMed Central  Google Scholar 

  43. Athiyyah AF, Utsumi T, Wahyuni RM, Dinana Z, Yamani LN, Soetjipto, et al. Molecular Epidemiology and Clinical Features of Rotavirus Infection Among Pediatric Patients in East Java, Indonesia During 2015–2018: Dynamic Changes in Rotavirus Genotypes From Equine-Like G3 to Typical Human G1/G3. Front Microbiol. 2019;10:940 Available from: https://www.frontiersin.org/article/10.3389/fmicb.2019.00940/full. [cited 2019 May 12].

    Article  PubMed  PubMed Central  Google Scholar 

  44. Walker CLF, Black RE. Diarrhoea morbidity and mortality in older children, adolescents, and adults. Epidemiol Infect. 2010;138(9):1215–26 Available from: http://www.ncbi.nlm.nih.gov/pubmed/20307341. [cited 2019 May 3].

    Article  PubMed  Google Scholar 

  45. Te Lee W, Lin PC, Lin LC, Chen HL, Yang RC. Salmonella/rotavirus coinfection in hospitalized children. Kaohsiung J Med Sci. 2012;28(11):595–600. https://doi.org/10.1016/j.kjms.2012.04.025.

    Article  PubMed  Google Scholar 

  46. Satter SM, Gastanaduy PA, Islam K, Rahman M, Rahman M, Luby SP, et al. Hospital-based Surveillance for Rotavirus Gastroenteritis Among Young Children in Bangladesh: Defining the Potential Impact of a Rotavirus Vaccine Program. Pediatr Infect Dis J. 2017;36(2):168–72 Available from: http://www.ncbi.nlm.nih.gov/pubmed/27798545. [cited 2018 Sep 23].

    Article  PubMed  PubMed Central  Google Scholar 

  47. Maneekarn N, Khamrin P. Rotavirus associated gastroenteritis in Thailand. Virus Dis. 2014;25(2):201–7 Available from: http://www.ncbi.nlm.nih.gov/pubmed/25674586. [cited 2018 Sep 23].

    Article  Google Scholar 

  48. Bahl R, Ray P, Subodh S, Shambharkar P, Saxena M, Parashar U, et al. Incidence of Severe Rotavirus Diarrhea in New Delhi, India, and G and P Types of the Infecting Rotavirus Strains. J Infect Dis. 2005;192(s1):S114–9 Available from: https://academic.oup.com/jid/article-lookup/doi/10.1086/431497. [cited 2018 Sep 23].

    Article  PubMed  Google Scholar 

  49. Rao MR, Naficy AB, Savarino SJ, Abu-Elyazeed R, Wierzba TF, Peruski LF, et al. Pathogenicity and convalescent excretion of Campylobacter in rural Egyptian children. Am J Epidemiol. 2001;154(2):166–73 Available from: http://www.ncbi.nlm.nih.gov/pubmed/11447051. [cited 2018 Sep 23].

    Article  CAS  PubMed  Google Scholar 

  50. Coker AO, Isokpehi RD, Thomas BN, Amisu KO, Obi CL. Human campylobacteriosis in developing countries. Emerg Infect Dis. 2002;8(3):237–44 Available from: http://www.ncbi.nlm.nih.gov/pubmed/11927019. [cited 2018 Sep 23].

    Article  PubMed  PubMed Central  Google Scholar 

  51. Hussain I, Shahid Mahmood M, Akhtar M, Khan A. Prevalence of Campylobacter species in meat, milk and other food commodities in Pakistan. Food Microbiol. 2007;24(3):219–22 Available from: http://linkinghub.elsevier.com/retrieve/pii/S0740002006001109. [cited 2018 Sep 23].

    Article  PubMed  Google Scholar 

  52. Nisar M, Ahmad M ud D, Mushtaq MH, Shehzad W, Hussain A, Nasar M, et al. Occurrence of Campylobacter in retail meat in Lahore, Pakistan. Acta Trop. 2018. 185:42–5. Available from: http://www.ncbi.nlm.nih.gov/pubmed/29709629. [cited 2018 Sep 23]

    Article  PubMed  Google Scholar 

  53. Bilenko N, Levy A, Dagan R, Deckelbaum RJ, El-On Y, Fraser D. Does co-infection with Giardia lamblia modulate the clinical characteristics of enteric infections in young children? Eur J Epidemiol. 2004;19(9):877–83 Available from: http://www.ncbi.nlm.nih.gov/pubmed/15499898. [cited 2018 Sep 23].

    Article  PubMed  Google Scholar 

  54. Sai L, Sun J, Shao L, Chen S, Liu H, Ma L. Epidemiology and clinical features of rotavirus and norovirus infection among children in Ji’nan, China. Virol J. 2013;10(1):302 Available from: http://virologyj.biomedcentral.com/articles/10.1186/1743-422X-10-302. [cited 2019 May 3].

    Article  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgments

We are grateful to Pakistan institute of medical Sciences (PIMS), Islamabad and head of paediatrics department of Benazir Bhutto Hospital (BBH) Rawalpindi, Dr. Rai Asghar for their support in collection of demographic data and tool specimens. We are also thankful to Parents and guardians of the study participants and the department of Biosciences COMSATS University Islamabad, Pakistan.

Funding

No funding is obtained for this study.

Author information

Authors and Affiliations

  1. Department of Biosciences, COMSATS University (CUI), Tarlai Kalan, Chak Shahzad, Islamabad, 45550, Pakistan

    Asma Sadiq, Habib Bokhari, Zobia Noreen & Nazish Bostan

  2. Department of Paediatrics, Benazir Bhutto Hospital, Rawalpindi, Pakistan

    Rai Muhammad Asghar

Authors
  1. Asma Sadiq
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Habib Bokhari
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Zobia Noreen
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Rai Muhammad Asghar
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Nazish Bostan
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

NB and HB conceived concept and designed the experiment. AS collected data, performed data analysis. AS and ZN performed the experiments. AS wrote the manuscript. NB and HB contributed reagents, helped in write-ups and final critical reviewing and editing of the manuscript. RMI helped in the provision of stool samples. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Habib Bokhari or Nazish Bostan.

Ethics declarations

Ethics approval and consent to participate

Written permission were taken from the parents/guardians of study participants. Ethical approval was taken from the respective ethical committees of Pakistan Institute of Medical Sciences (PIMS), Benazir Bhutto Shaheed Hospital (BBH) and Internal Review Board (IRB) of COMSATS Institute of Information Technology, Islamabad.

Consent for publication

Not Applicable

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Sadiq, A., Bokhari, H., Noreen, Z. et al. Magnitude of Rotavirus A and Campylobacter jejuni infections in children with diarrhea in Twin cities of Rawalpindi and Islamabad, Pakistan. BMC Infect Dis 19, 978 (2019). https://doi.org/10.1186/s12879-019-4575-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12879-019-4575-1

Keywords

BMC Infectious Diseases

ISSN: 1471-2334

Contact us