A 60-year-old man presented with sudden severe right shoulder and flank pain and numbness of the right hand. The patient had a history of working in his home garden every day. He had no subjective symptoms prior to the day of admission, and no past medical history other than hypertension, which was managed with medication. The patient called an ambulance 3 h after the onset of symptoms and was able to get into the ambulance unassisted. He was transported to a nearby hospital. At the hospital, he developed hemoptysis and hypoxemia with severe forced breathing and tachypnea. He was tracheally intubated and transferred to our emergency department by air ambulance helicopter 6 h after the onset of symptoms.
On examination in our emergency department, a coarse crackle with right lateral dominance was audible. A small volume of blood was continuously suctioned through the tracheal tube, although bronchoscopic examination did not reveal any source of bleeding. The patient’s blood pressure was 132/87 mmHg, pulse was 109 beats per minute and body temperature was 36.7 °C. He was mechanically ventilated with spontaneous breathing at a rate of 14 breaths per minute under sedation. No skin eruptions or lesions were observed.
Upon examination of chest computed tomography (CT), we saw infiltration predominant in the right upper lobe and spreading to the right middle and lower lobe and left hilar area (Fig. 1). Peripheral blood was collected for laboratory examination. Arterial blood gas analysis showed a pH of 7.174, with a partial pressure of carbon dioxide of 62.4 mmHg, a partial pressure of oxygen of 94.3 mmHg, a base deficit of − 7.4. under the condition of end-expiratory pressure at 10 cm H2O, and a fraction of inspired oxygen of 0.5, indicating acute respiratory failure. Other laboratory data were normal, including blood cell count, coagulation, and biochemistry, including inflammatory biomarkers, other than a slight elevation in serum creatinine level (1.37 mg/dL).
Electrocardiography showed a sinus rate of 86 beats per minute, with an obvious ST segment elevation in the inferior leads. Echocardiography also showed severe hypokinesis of the cardiac inferior wall. The patient’s serum troponin T level was elevated (0.487 ng/mL).
The patient’s history was obtained from his family, and showed only hypertension. His current medications included enalapril, carvedilol, and amlodipine. He had no known allergies and no recent travel history. He did not smoke and there was no history of unusual ingestions. The Triage DOA® intoxication screening test result was negative.
From the laboratory results and other tests, there were two contradictory clinical concerns: revascularization of the coronary artery and alveolar hemostasis. As the etiology of the alveolar hemorrhage was unknown, we were obliged to seek the pathogenesis under mechanical ventilation, with no obvious indicators for a hemostatic approach. Thus, after discussion, we decided to prioritize the revascularization of the coronary artery. After heparinization, coronary angiography confirmed 99% severe stenosis with a flow delay (thrombolysis in myocardial infarction grade 2 flow) of the mid right coronary artery at segment 2. Thrombus aspiration was performed, followed by implantation of a drug-eluting stent (DES). To minimize the bleeding risk, we delayed administration of antiplatelet drugs, aspirin and prasugrel, until the time of definite decision to implant the DES.
Next, transcatheter arterial embolization was performed to treat the alveolar hemorrhage. Although we did not detect overt extravasation by angiography, we believed that the location of the hemorrhage was a branch of the right bronchial artery, which we embolized using a gelatin sponge. However, we were unable to control the alveolar hemorrhage, which increased and blew out from the tracheal tube, making it very difficult to maintain oxygenation and circulation. The patient died 12 h after the onset of symptoms. No antibiotics were administered during treatment.
Autopsy was performed with the family’s consent immediately after the patient’s death.
The following day, additional laboratory blood exams revealed that negative for the anti-neutrophil cytoplasmic antibody, anti-nuclear antibody, and anti-glomerular basement membrane antibody. Levels of lung surfactant proteins A and D, as well as KL-6, were normal. Later, B. cereus was cultured from the sputum sample suctioned through the tracheal tube.
Immunohistochemistry of B. cereus and real-time PCR for pXO1-like plasmid from lung tissue were performed to confirm that the bacterium was B. cereus and whether this bacterium produced anthrax-like toxin.
The lungs were fixed in 20% formalin for 24 h and embedded in paraffin, followed by pathological examination. B. cereus immunostaining was performed using anti-Bacillus cereus rabbit polyclonal antibody (Abcam, Cambridge, UK).
Next, we performed DNA extraction and real-time PCR for B. anthracis toxin plasmid. Two pieces of 10 μm-thick Formalin fixed paraffin embedded (FFPE) sections were collected in Eppendorf tubes. DNA was extracted from these sections with the use of Nucleospin DNA FFPE XS kit (Macherey-Nagel, Düren, Germany), according to the manufacturer’s instruction. For detecting infection with B. cereus containing pXO1-like plasmid, lethal factor (LF) gene (Genbank M29081.1) and protective antigen gene (PAg) (Genbank AF268967.1) were amplified by real-time PCR. For amplifying LF, two primer sets were prepared.: LF1, 5′- CAGCTTTATGCACCGGAAGC-3′ (forward) and 5′- CGCTCCAGTGTTGATAGTGC-3′ (reverse), generating a product of 148 bp; and LF2, 5′- TCAGCTTAAGGAACATCCCACA -3′ (forward) and 5′- GCTTCCGGTGCATAAAGCTG-3′ (reverse), generating a product of 144 bp. PAg was amplified using the primers 5′- CAGGCTCGAACTGGAGTGAA -3′ (forward) and 5′- TCACTAGGATTAACCGCCGC -3′ (reverse), generating a product of 118 bp. PCR reactions were carried out in a 25-μL final volume containing 2 μL of sample DNA, 12.5 μl of 2× reaction mixture (QuantiTect SYBR Green PCR Kits; Qiagen, Hilden, Germany) and 0.2 μM primers. The real-time PCR was performed with Rotor Gene Q (Qiagen), with an initial holding step at 95 °C for 15 min, followed by 50 cycles of three-step PCR (94 °C for 15 s, 55 °C for 30 s, and 72 °C for 30 s) with SYBR Green fluorescence monitoring to detect amplification. The melting curve was examined to check for contamination. As a positive control, genomic DNA of Bacillus anthracis (JNBP01251) was provided by the Gifu Type Culture Collection, Graduate School of Medicine, Gifu University.
Histologic sections of the lung, especially of the right upper lobe, demonstrated necrotizing hemorrhagic pneumonia similar to anthrax, with tremendous proliferation of gram-positive rods. The bacteria were diffusely gram-positive. Additionally, hemorrhagic diffuse alveolar damage within the hyaline membrane that was probably due to acute respiratory distress syndrome was also observed throughout the lungs. The bacteria reacted to the B. cereus antibody, and did not react to Pseudomonas aeruginosa and Escherichia coli antibodies. There was no infiltration of neutrophils. There was also no deposition of immunoglobulins or complements on the alveolar walls by immunofluorescence, excluding a diagnosis of vasculitis. B. cereus was also confirmed from the sputum culture. Therefore, B. cereus necrotizing pneumonia was confirmed pathologically (Fig. 2).
In the real-time PCR, amplification was obtained in the positive control (B. anthracis DNA), but not in the patient sample or the negative control (no template).
