Skip to main content

Table 1 Primers used and strains detected by conventional PCR.

From: Usefulness of real time PCR for the differentiation and quantification of 652 and JP2 Actinobacillus actinomycetemcomitans genotypes in dental plaque and saliva

Name Target Strain Sequence 5'--------------3' GenBank Accession No PCR product (bp)
OG 43 16S rRNA Actinobacillus actimycetemcomitans CCAAGTGTGATTAGGTAGTT M75036 226
OG 44 16S rRNA Actinobacillus actimycetemcomitans ACCAACCTTCCTCAATAC M75036  
OG53 16S rRNA Prevotella intermedia CGTATCCAACCTTCCCTCC X73965 389
OG54 16S rRNA Prevotella intermedia ATTAGCCGGTCCTTATTCGAAG X73965  
OG94 prtC Porphyromonas gingivalis GAATCAAATACTTCAGCCGTCT AB006973 143
OG95 prtC Porpyromonas gingivalis TTGCAGTTCGTATCGGATCT AB006973  
OG45 16S rRNA Tannerella forsythensis GTCGGACTAATACCTCATAAAACA L16495 222
OG46 16S rRNA Tannerella forsythensis TCGCCCATTGACCAATATT L16495  
OG348 16S rRNA Treponema denticola AGAGAAAGGGTAATTTGAAG AF179264 399
OG349 16S rRNA Treponema denticola TATTATTGTCCCTTCTTTCTT AF179264