The RdRp genotyping of SARS-CoV-2 isolated from patients with different clinical spectrum of COVID-19

BMC Infectious Diseases

Table 2 Amplified regions, oligonucleotide primers, amplicons and PCR conditions, Tan – temperature annealing, Pcon – final primer concentration, bp – base pairs. Amplified regions were marked based on SARS-CoV-2 reference strain NC_045512.2 genome

PCR	Amplified region	Primer name	Primer sequence	Amplicon (bp)	T_an [°C]	P_con [μM]
#1	13,166–13,829	RdRp1F	5′- CACACTGGTACTGGTCAGGC - 3’	664	59	0.3
#1	13,166–13,829	RdRp1R	5′- GCATAGACGAGGTCTGCCAT - 3’	664	59	0.3
#2	13,712–14,328	RdRp2F	5′- AGGATTGTCCAGCTGTTGCT - 3’	617	57	0.5
#2	13,712–14,328	RdRp2R	5′- TGGGTGGTATGTCTGATCCC - 3’	617	57	0.5
#3	14,258–14,787	RdRp3F	5′- ATGACTTCACGGAAGAGAGGT - 3’	530	58	0.5
#3	14,258–14,787	RdRp3R	5′- AGCAGCATTACCATCCTGAGC - 3’	530	58	0.5
#4	14,700–15,546	RdRp4F	5′- TGACTTTGCTGTGTCTAAGGGT - 3’	846	54	0.5
#4	14,700–15,546	RdRp4R	5′- GCCGTGACAGCTTGACAAAT - 3’	846	54	0.5

ISSN: 1471-2334