Skip to main content

Table 1 List of primers and thermal condition used for molecular identification of Campylobacter species

From: Occurrence and multidrug resistance of Campylobacter spp. at duck farms and associated environmental and anthropogenic risk factors in Bangladesh

Primer Sequence (5′-3′) Target Amplicon size (bp) PCR condition (30 cycle) References
Denature Annealing Extension
16S9F
16S1540R
GAGTTTGATCCTGGCTC
AAGGAGGTGATCCAGCC
16S rRNA 1530 94 °C, 30 s 47 °C, 30 s 72 °C, 90 s Samosornsuk et al. [21]
HIP400F
HIP1134R
GAAGAGGGTTTGGGTGGTG
AGCTAGCTTCGCATAATAACTTG
hipO gene 735 94 °C, 30 s 55 °C, 30 s 72 °C, 45 s Linton et al. [22]
Cj-cdtCU1
Cj-CdtCR2
TTTAGCCTTTGCAACTCCTA
AAGGGGTAGCAGCTGTTAA
Cj-cdtC 524 94 °C, 30 s 53 °C, 30 s 72 °C, 30 s Asakura et al. [23]
Cc-CdtCU1
Cc-CdtCR1
TAGGGATATGCACGCAAAG
GCTTAATACAGTTACGATAG
Cc-cdtC 313
CfspCU2
CfspCR1
AAGCATAAGTTTTGCAAACG
GTTTGGATTTTCAAATGTTCC
Cf-cdtC 397
  1. Cj: C. jejuni; Cc: C. coli; Cf: C. fetus