Skip to main content

Table 1 The prediction of target genes of miRNAs

From: microRNA-125b-5p is a promising novel plasma biomarker for alveolar echinococcosis in patients from the southern province of Qinghai

miRNA name Log2 (G2/G1) P-value Target Sequence (5′ to 3′) Accession No.
hsa-miR-6849-3p −7.96 0.015 ACCAGCCUGUGUCCACCUCCAG MIMAT0027599
hsa-miR-3165 −3.93 0.047 AGGUGGAUGCAAUGUGACCUCA MIMAT0015039
hsa-miR-377-5p −2.96 0.046 AGAGGUUGCCCUUGGUGAAUUC MIMAT0004689
hsa-miR-4725-3p −1.97 0.035 UGGGGAAGGCGUCAGUGUCGGG MIMAT0019844
hsa-miR-937-5p −7.42 0.001 GUGAGUCAGGGUGGGGCUGG MIMAT0022938
hsa-miR-203a-3p 6.88 0.003 GUGAAAUGUUUAGGACCACUAG MIMAT0000264
hsa-miR-577 3.11 0.005 UAGAUAAAAUAUUGGUACCUG MIMAT0003242
hsa-miR-7113-3p 6.38 0.006 CCUCCCUGCCCGCCUCUCUGCAG MIMAT0028124
hsa-miR-125b-5p 2.42 0.0126 UCCCUGAGACCCUAACUUGUGA MIMAT0000423
hsa-miR-6738-3p 3.20 0.0143 CUUCUGCCUGCAUUCUACUCCCAG MIMAT0027378
hsa-miR-32-5p 5.09 0.0153 UAUUGCACAUUACUAAGUUGCA MIMAT0000090
hsa-miR-938 −2.01 0.0881 UGCCCUUAAAGGUGAACCCAGU MIMAT0004981
hsa-let-7e-5p −3.07 0.0182 UGAGGUAGGAGGUUGUAUAGUU MIMAT0000066
hsa-miR-935 −5.77 0.0251 CCAGUUACCGCUUCCGCUACCGC MIMAT0004978
hsa-miR-382-5p −3.91 0.056 GAAGUUGUUCGUGGUGGAUUCG MIMAT0000737
hsa-miR-520e −1.49 0.00623 AAAGUGCUUCCUUUUUGAGGG MIMAT0002825