Skip to main content

Table 1 Nucleotide sequences of the primers used for real-time PCR to quantify ANXA1, FPR1, FPR2 and FPR3 mRNA levels

From: Low Annexin A1 level in HTLV-1 infected patients is a potential biomarker for the clinical progression and diagnosis of HAM/TSP

Primer Sequence (5′-3′) Direction
ANXA1F GATTTTCGGAACGCTTTGCT Forward
ANXA1R AGTCCTCAGATCGGTCACCCT Reverse
FPR1F ACCCAGAGCAAGACCACAGC Forward
FPR1R TCCATCTTGTCTGCTCCTGCA Reverse
FPR2F ATTTGCAGCCTTGAGGTCA Forward
FPR2R AGCACCTGGTGCATTTTCCT Reverse
FPR3F GGATGACACGCACAGTCAACA Forward
FPR3R TCAGCTAGGGCCAGGTTCAG Reverse
BACTINAF TCCCTGGAGAAGAGCTACG Forward
BACTINAR TAGTTTCGTGGATGCCACA Reverse