Skip to main content

Table 1 The primer sequences included in the C. jejuni capsule typing scheme

From: High prevalence of Campylobacter jejuni CC21 and CC257 clonal complexes in children with gastroenteritis in Tehran, Iran

Primer Forward sequence Reverse sequence Product size (bp) Reference
HS1 GCAAGAGAAACATCTCGCCTA TTGGCGGTAAGTTTTTGAAGA 610 [5]
HS2 CATCCTAGCACAACTCACTTCA CAGCATTGGAGGATTTACAATATAT 62 [5]
HS4A CCTAACATATCATACACTACGGT TATATTTGGTTAGGGATCCA 370 [5]
HS19 GGCAACAAACAAACATATTCAGA CGAGGATGAAAATGCCTCAA 450 [5]
HS23/36 GCTTTATATCTATCCAGTCCATTATCA GCTTGGGAGATGAATTTACCTTTA 161 [5]
HS41 TGCAATCTCTAAAGCCCAAG CTTACATATGCTGGTAGAGATGATATG 279 [5]