Development and evaluation of a TaqMan MGB RT-PCR assay for detection of H5 and N8 subtype influenza virus

BMC Infectious Diseases

Table 1 Primers and probes used in multiplex real-time RT-PCR assays

Name	Sequence (5′ → 3′)	Position	Product
H5 Forward primer	AATGGGACGTATGACTAC	1495–1512	142 bp
H5 Reverse primer	TTGCCAGTGYTAGGGAAC	1619–1636
H5 Probe	FAM-CAATAGGAACTTAC-MGB	1570–1583
N8 Forward primer	TGGGTCTTTCACTTTACCAG	1209–1228	131 bp
N8 Reverse primer	CTCCATCGTGCCATGACC	1364–1381
N8 Probe	HEX-CATTGTRATGTGTG-MGB	1326–1339

Note: Primers and probes were targeted to the conserved regions of the H5-HA and N8-NA genes, and the H5 gene-specific probe was labelled with FAM at the 5′ end, while the N8 gene-specific probe was labelled with HEX to allow specific detection of H5N8 AIVs in a single reaction. The specific primers and probes were designed based on the nucleotide sequences of 781 H5N8-HA genes (including high pathogenic and low pathogenic H5N8), obtained from the GenBank database, using Primer Express software. By in silico analysis of published H5N8 sequence data, the primers and probes of H5 and N8 could perfectly match the 94.36% (737/781) and 92.8% (725/781) sequences, respectively. And 250 H5-HA genes (H5N1, H5N2, H5N6 and H5N8) from currently circulating clades (2.3.2, and 2.3.4.4) were obtained from the GenBank database, and the results showed 95.2% (238/250) sequences matched

ISSN: 1471-2334