Skip to main content

Table 1 Nested PCR (nPCR) conditions as well as oligonucleotide primers used in this study

From: Asymptomatic-anaplasmosis confirmation using genetic and serological tests and possible coinfection with spotted fever group Rickettsia: a case report

Target genea Primer name (sequences; 5′ → 3′) Amplicon size
(bp)
groEL nPCR for Anaplasmataceae
(external primers)
GRO607F (GAAGATGCWGTWGGWTGTACKGC)
GRO1294R (AGMGCTTCWCCTTCWACRTCYTC)
539
groEL nPCR for Anaplasmataceae
(internal primers)
GRO677F (ATTACTCAGAGTGCTTCTCARTG)
GRO1121R (TGCATACCRTCAGTYTTTTCAAC)
450
16S rRNA nPCR for Anaplasma and Ehrlichia species (external primers) AE1-F (AAGCTTAACACATGCAAGTCGAA)
AE1-R (AGTCACTGA CCCAACCTTAAATG)
1406
16S rRNA nPCR for
A. phagocytophilum
(internal primers)
AP-F (GTCGAACGGATTATTCTTTATAGCTTGC)
AP-R (CCCTTCCGTTAAGAAGGATCTAATCTCC)
926
ankA nPCR for
A. phagocytophilum
(external primers)
ANK-F1 (GAAGAAATTACAACTCCTGAAG)
ANK-R1 (CAGCCAGATGCAGTAACGTG)
705
ankA nPCR for
A. phagocytophilum
(internal primers)
ANK-F2 (TTGACCGCTGAAGCACTAAC)
ANK-R2 (ACCATTTGCTTCTTGAGGAG)
664
sca1 nPCR for SFG
Rickettsia (external primers)
sca1-6545F (ATTCGTAACAGATTAGATRC)
sca1-7360R (TTATAGGATGTTTTCGGTTG)
815
sca1 nPCR for SFG Rickettsia (internal primers) sca1-6647F (TGGATGCGTGSTATGTACG)
sca1-7354R (GATGTTTTCGGTTGYTTCGG)
707
ompA nPCR for SFG Rickettsia (external primers) R190.70F (ATGGCGAATATTTCTCCAAAAA)
RR190.701R (GTTCCGTTAATGGCAGCATCT)
634
ompA nPCR for SFG Rickettsia (internal primers) R190.70F (ATGGCGAATATTTCTCCAAAAA)
RR190.602R (AGTGCAGCATTCGCTCCCCCT)
535
  1. aankA ankyrin-repeat protein gene, groEL heat shock protein chaperone gene, rRNA ribosomal RNA, sca1 surface cell antigen 1 (rickettsial surface protein) gene, ompA outer membrane protein A gene