Skip to main content

Table 1 Primers used in this study, and the results of SCCmec types I–V

From: Molecular characteristics and virulence gene profiles of Staphylococcus aureus isolates in Hainan, China

Primer Nucleotide sequence(5′-3′) Target gene Amplicon size(bp) SCCmec type
I II III IV IVa IVb IVc IVd V
β ATTGCCTTGATAATAGCCYTCT ccrA2-B 937   X   X      
a3 TAAAGGCATCAATGCACAAACACT            
ccrCF CGTCTATTACAAGATGTTAAGGATAAT ccrC 518    X       X
ccrCR CCTTTATAGACTGGATTATTCAAAATAT            
1272F1 GCCACTCATAACATATGGAA IS1272 415 X    X      
1272R1 CATCCGAGTGAAACCCAAA            
5RmecA TATACCAAACCCGACAACTAC mecA–IS431 359          X
5R431 CGGCTACAGTGATAACATCC            
Type IVa-F GCCTTATTCGAAGAAACCG 776      X     
Type IVa-R CTACTCTTCTGAAAAGCGTCG            
Type IVb-F TCTGGAATTACTTCAGCTGC 493       X    
Type IVb-R AAACAATATTGCTCTCCCTC            
Type IVc-F ACAATATTTGTATTATCGGAGAGC 200        X   
Type IVc-R TTGGTATGAGGTATTGCTGG            
Type IVd-F CTCAAAATACGGACCCCAATACA 881         X  
Type IVd-R TGCTCCAGTAATTGCTAAAG            
Spa-1113f TAAAGACGATCCTTCGGTGAGC spa          
Spa-1514r CAGCAGTAGTGCCGTTTGCTT            
arcC-F TTGATTCACCAGCGCGTATTGTC arcC 456          
arcC-R AGG TATCTGCTTCAATCAGCG            
aroE-F ATCGGAAATCCTATTTCACATTC aroE 456          
aroE-R GGTGTTGTATTAATAACGATATC            
glpF-F CTAGGAACTGCAATCTTAATCC glpF 465          
glpF-R TGGTAAAATCGCATGTCCAATTC            
gmk-F ATCGTTTTATCGGGACCATC gmk 417          
gmk-R TCATTAACTACAACGTAATCGTA            
pta-F GTTAAAATCGTATTACCTGAAGG pta 474          
pta-R GACCCTTTTGTTGAAAAGCTTAA            
tpi-F TCGTTCATTCTGAACGTCGTGAA tpi 402          
tpi-R TTTGCACCTTCTAACAATTGTAC            
yqiL-F CAGCATACAGGACACCTATTGGC yqiL 516          
yqiL-R CGTTGAGGAATCGATACTGGAAC            
PVL-F ATCATTAGGTAAAATGTCTGGACATGATCCA pvl 433          
PVL-R GCATCAASTGTATTGGATAGCAAAAGC            
FnbA-F GTGAAGTTTTAGAAGGTGGAAAGATTAG fnbA 643          
FnbA-R GCTCTTGTAAGACCATTTTTCTTCAC            
FnbB-F GTAACAGCTAATGGTCGAATTGATACT fnbB 524          
FnbB-R CAAGTTCGATAGGAGTACTATGTTC            
Hla-F CTGATTACTATCCAAGAAATTCGATTG hla 209          
Hla-R CTTTCCAGCCTACTTTTTTATCAGT            
Hlb-F GTGCACTTACTGACAATAGTGC hlb 309          
Hlb-R GTTGATGAGTAGCTACCTTCAGT            
Sea-F GAAAAAAGTCTGAATTGCAGGGAACA sea 560          
Sea-R CAAATAAATCGTAATTAACCGAAGGTTC            
Seb-F ATTCTATTAAGGACACTAAGTTAGGGA seb 404          
Seb-R ATCCCGTTTCATAAGGCGAGT            
Sec-F GTAAAGTTACAGGTGGCAAAACTTG sec 297          
Sec-R CATATCATACCAAAAAGTATTGCCGT            
eta-F CGCTGCGGACATTCCTACATGG eta 676          
eta-R TACATGCCCGCCACTTGCTTGT            
etb-F CAGATAAAGAGCTTTATACACACATTAC etb 612          
etb-R AGTGAACTTATCTTTCTATTGAAAAACACTC            
clfA-F ATTGGCGTGGCTTCAGTGCT clfa 292          
clfA-R CGTTTCTTCCGTAGTTGCATTTG            
ermA-F GTTCAAGAAC AATCAATACA GAG ermA 421          
ermA-R GGATCAGGAA AAGGACATTT TAC            
ermB-F CCGTTTACGA AATTGGAACA GGTAAAGGGC ermB 359          
ermB-R GAATCGAGAC TTGAGTGTGC            
ermC-F GCTAATATTG TTTAAATCGT CAATTCC ermC 572          
ermC-R GGATCAGGAA AAGGACATTT TAC            
tetM-F AGTGGAGCGATTACAGAA tetM 158          
tetM-R CATATGTCCTGGCGTGTCTA            
tetK-F GTAGCGACAATAGGTAATAGT tetK 360          
tetK-R GTAGTGACAATAAACCTCCTA            
tetL-F ATAAATTGTTTCGGGTCGGTAAT tetL 1077          
tetL-R AACCAGCCAACTAATGACAATGAT            
tetO-F AACTTAGGCATTCTGGCTCAC tetO 514          
tetO-R TCCCACTGTTCCATATCGTCA