Skip to main content

Table 1 Sequence of primers for detection of gyrA, gyrB, parC and parE genes

From: Chromosomal and plasmid-mediated fluoroquinolone resistance in human Salmonella enterica infection in Ghana

Target gene Nucleotide sequence (5′ -3′) Product size (bp) References
GyrA F 5′ –ATGAGCGACCTTGCGAGAGAGAAATACACCG − 3′ 632 [25]
R 5′ – TTCCATCAGCCCTTCAATGCTGAGTCTTC − 3′
GyrB F 5′ – AAGCGCGATGGCAAAGAAG − 3′ 1500 [25]
R 5′ – AACGGTCTGCTCATCAGAAAGG − 3′
ParC F 5′- CTATGCGATGTCAGAGCTGG − 3′ 270 [26]
R 5′- TAACAGCAGCTCGGCGTATT − 3′
ParE F 5′- TCTCTTCCGATGAAGTGCTG − 3′ 240 [26]
R 5′- ATACGGTATAGCGGCGGTAG − 3′