Skip to main content

Table 2 List of primers employed in polymerase chain reaction in this study

From: A case report of pulmonary Botrytis sp. infection in an apparently healthy individual

Target Region Primer Name Primer Sequence (5’ to 3’) Reference
ITS ITS1 TCCGTAGGTGAACCTGCGG [4]
ITS4 TCCTCCGCTTATTGATATGC
Domain 1 and 2 NL-1 GCATATCAATAAGCGGAGGAAAAG [5]
NL-4 GGTCCGTGTTTCAAGACGG
G3PDH G3PDHfor ATTGACATCGTCGCTGTCAACGA [6]
G3PDHrev ACCCCACTCGTTGTCGTACCA
HSP60 HSP60for CAACAATTGAGATTTGCCCACAAG [6]
HSP60rev GATGGATCCAGTGGTACCGAGCAT
RPB2 RPB2for GATGATCGTGATCATTTCGG [6]
RPB2rev CCCATAGCTTGCTTACCCAT