Skip to main content

Table 2 Amplification and sequencing primers for Sanger sequencing

From: Evaluation of the SpeeDx Carba (beta) multiplex real-time PCR assay for detection of NDM, KPC, OXA-48-like, IMP-4-like and VIM carbapenemase genes

Set Forward primer (5′-3′) Reverse primer (5′-3′) Amplicon size (bp)
OXA-48-like CCTCGATTTGGGCGTGGTTA TCCGATGTGGGCATATCCAT 475
IMP-4-like GAAGGTGTTTATGTTCATACTTCGT TCACTGTGACTTGGAACAACCAGTTTTGC 557
VIM GAGTTGCTTTTGATTGATACAGC TCGGTCGAATGCGCAGCACC 291