Skip to main content

Table 1 Oligonucleotides for in-house assays in this study

From: Evaluation of the SpeeDx Carba (beta) multiplex real-time PCR assay for detection of NDM, KPC, OXA-48-like, IMP-4-like and VIM carbapenemase genes

Set Forward primer (5′-3′) Reverse primer (5′-3′) Probe Reference
KPCa GGCCGCCGTGCAATAC GCCGCCCAACTCCTTCA FAM-TGATAACGCCGCCGCCAATTTGT-BHQ1 [18]
NDMa GACCGCCCAGATCCTCAA CGCGACCGGCAGGTT VIC-TGGATCAAGCAGGAGAT-MGB-NFQ [18]
OXA-48-like GTAGCAAAGGAATGGCAA CCTTGCTGCTTATTcTCAc FAM-TCC(+A)GA(+G)CA(+C)AA(+C)TACG-Dabcyl [19]
IMP-4-likeb GGCAGTATTTCCTCTCATTT GCAGCTCATTAGTTAATTCAG FAM-CATAGTGACAGCACGGGCGGAAT-BHQ1 [20]
VIMb CGCGGAGATTGAGAAGCAAA AGCCGCCCGAAGGACATC HEX-TTGGACTTCCTGTAACGCGTGCA-BHQ1 [20]
16S rRNAa TGGAGCATGTGGTTTAATTCGA TGCGGGACTTAACCCAACA Quasar670-CACGAGCTGACGACARCCATGCA-BHQ2 [18]
  1. aKPC, NDM and 16S rRNA oligonucleotides were tested together in a multiplex PCR as previously described [18]
  2. bIMP-4-like and VIM oligonucleotides were tested together in a multiplex PCR as previously described [20]
  3. cThe lower case base differed to that of the original primer (C instead of G) and was substituted based on OXA-48-like sequence data on the Genbank database
  4. ‘+’ indicates locked nucleic acid (LNA) bases; MGB minor groove binder, BHQ black hole quencher, NFQ non-fluorescent quencher