Skip to main content

Table 2 Primer sequences designed to amplify the gltA and groEL genes in this study

From: Molecular identification and characterization of Anaplasma capra and Anaplasma platys-like in Rhipicephalus microplus in Ankang, Northwest China

Pathogens Target gene Oligonucleotide sequences (5′- 3′) Fragment
A. platys gltA (partial) Pglt-F: ATGAWAGAAAAWGCTGTTTT (+) /
   Pglt-R1: TCATGRTCTGCATGCATKATG (−)
   Pglt-R2: CATGCATKATGAARATMGCAT (−)
  groEL (partial) Pgro-F1: TTGATCATCGCTGAAGACGT (+) /
   Pgro-F2: ACTCTCGTCTTGAACAAGCT (+)
   Pgro-R: CCACTCTGTCTTTACGCTCT (−)
  gltA (nearly complete) Pglt-F: ATGAWAGAAAAWGCTGTTTT (+) Former
   Pglt-R1: TCATGRTCTGCATGCATKATG (−)
   Pglt-R2: CATGCATKATGAARATMGCAT (−)
   Pglt-L-F1: GATGCWCATCCYATSGCMATGT (+) Latter
   Pglt-L-F2: CGTGMTSGCTATAGCGMAART (+)
   Pglt-L-R: TCAYACCATTGDGAYRCCCAT (−)
  groEL (nearly complete) Pgro-F-F: AAATGKCAAATACGGTWGTC (+) Former
   Pgro-F-R1: ACAACACCTTCCTCKACAGC (−)
   Pgro-F-R2: CTGKCTTTRCGYTCTTTAACTTC (−)
   Pgro-L-F1: GAYGGTATGCAGTTTGATCGCG (+) Latter
   Pgro-L-F2: ATGCAGTTTGATCGCGGWTATC (+)
   Pgro-L-R: CAGCRAGGTCGAAYGCAATAC (−)