Skip to main content

Table 1 Primer sequences used in this study for detection of Anaplasma species pathogenic to humans

From: Molecular identification and characterization of Anaplasma capra and Anaplasma platys-like in Rhipicephalus microplus in Ankang, Northwest China

Pathogens Target gene Primer Oligonucleotide sequences (5′- 3′) References
A. phagocytophilum rrs EE1 TCCTGGCTCAGAACGAACGCTGGCG (+) Barlough et al. [22]
   EE2 AGTCACTGACCCAACCTTAAATGGCTG (−) Barlough et al. [22]
   SSAP2f GCTGAATGTGGGGATAATTTAT (+) Kawahara et al. [23]
   SSAP2r ATGGCTGCTTCCTTTCGGTTA (+) Kawahara et al. [23]
A. capra rrs   GCAAGTCGAACGGACCAAATCTGT (+) Yang et al. [26]
    CCACGATTACTAGCGATTCCGACTTC (−) Yang et al. [26]
   Ehr3 TGCATAGGAATCTACCTAGTAG (+) Rar et al. [28]
   Ehr4 CTAGGAATTCCGCTATCCTCT (−) Rar et al. [28]
A. ovis rrs EE1 TCCTGGCTCAGAACGAACGCTGGCG (+) Barlough et al. [22]
   EE2 AGTCACTGACCCAACCTTAAATGGCTG (−) Barlough et al. [22]
   297E ACACGGTCCAGACTCCTACG (+) Ochirkhuu et al. [24]
   1144R CTTGACATCATCCCCACCTT (−) Ochirkhuu et al. [24]
A. platys rrs PLATYS GATTTTTGTCGTAGCTTGCTATG (+) Martin et al. [27]
   Ehr2 AGTAYCGRACCAGATAGCCGC (−) Rar et al. [28]
   Ehr4 CTAGGAATTCCGCTATCCTCT (−) Rar et al. [28]