Skip to main content

Table 1 Primers and reaction conditions used to detect BLV DNA in human buffy coat cells

From: Bovine leukemia virus discovered in human blood

BLV gene Primer sequences 5′ to 3′ Location in bp* Nested PCR role Product length, bp Annealing temp, °C. Extension time, s
LTR F: TAGGAGCCGCCACCGC 23–38 Outer 329 57 22
R: GCGGTGGTCTCAGCCGA 352–336
F: CGTAAACCAGACAGAGACG 41–59 Inner 290 58 20
R: CACCCTCCAAACCGTGCTTG 331–312
gag F: AACACTACGACTTGCAATCC 1068–1087 Outer 385 54 28
R:GGTTCCTTAGGACTCCGTCG 1453–1434
F: ACCCTACTCCGGCTGACCTA 1097–1116 Inner 272 56 24
R:CTTGGACGATGGTGGACCAA 1369–1350
env F:CGGGCAAAACAATCGTCGGT 4701–4720 Outer 707 55 45
R:ACTGGGTTCCCTCTGTCAGA 5408–5389
F: CTCTCCTGGCTACTGACC 4763–4780 Inner 611 55 45
R: GGAAAGTCGGGTTGAGGG 5374–5357
tax F: TATTCCACCTCGGCAC 7153–7169 Outer 447 50 28
R: ATTGGCATTGGTAGGGCT 7600–7583
F: CTTCGGGATCCATTACCTGA 7197–7216 Inner 373 55 24
R: GCTCGAAGGGGGAAAGTGAA 7570–7551
  1. Abbreviations: bp base pair, F forward, R reverse, s seconds, temp temperature; bp* Base pair numbering is according to GenBank reference sequence EF600069
  2. Reverse primer sequences for GAPDH and all BLV genome regions are presented in reversed order and complementary to the proviral reference sequence