Bovine leukemia virus discovered in human blood

BMC Infectious Diseases

Table 1 Primers and reaction conditions used to detect BLV DNA in human buffy coat cells

BLV gene	Primer sequences 5′ to 3′	Location in bp*	Nested PCR role	Product length, bp	Annealing temp, °C.	Extension time, s
LTR	F: TAGGAGCCGCCACCGC	23–38	Outer	329	57	22
	R: GCGGTGGTCTCAGCCGA	352–336	Outer	329	57	22
	F: CGTAAACCAGACAGAGACG	41–59	Inner	290	58	20
	R: CACCCTCCAAACCGTGCTTG	331–312	Inner	290	58	20
gag	F: AACACTACGACTTGCAATCC	1068–1087	Outer	385	54	28
	R:GGTTCCTTAGGACTCCGTCG	1453–1434	Outer	385	54	28
	F: ACCCTACTCCGGCTGACCTA	1097–1116	Inner	272	56	24
	R:CTTGGACGATGGTGGACCAA	1369–1350	Inner	272	56	24
env	F:CGGGCAAAACAATCGTCGGT	4701–4720	Outer	707	55	45
	R:ACTGGGTTCCCTCTGTCAGA	5408–5389	Outer	707	55	45
	F: CTCTCCTGGCTACTGACC	4763–4780	Inner	611	55	45
	R: GGAAAGTCGGGTTGAGGG	5374–5357	Inner	611	55	45
tax	F: TATTCCACCTCGGCAC	7153–7169	Outer	447	50	28
	R: ATTGGCATTGGTAGGGCT	7600–7583	Outer	447	50	28
	F: CTTCGGGATCCATTACCTGA	7197–7216	Inner	373	55	24
	R: GCTCGAAGGGGGAAAGTGAA	7570–7551	Inner	373	55	24

Abbreviations: bp base pair, F forward, R reverse, s seconds, temp temperature; bp* Base pair numbering is according to GenBank reference sequence EF600069
Reverse primer sequences for GAPDH and all BLV genome regions are presented in reversed order and complementary to the proviral reference sequence

ISSN: 1471-2334