Skip to main content

Table 2 Oligonucleotide primers for capsular typing

From: Prevalence and capsular type distribution of Streptococcus agalactiae isolated from pregnant women in Namibia and South Africa

Primer name Sequence Band size (bp)
Ia-F
Ia-R
GGTCAGACTGGATTAATGGTATGC
GTAGAAATAGCCTATATACGTTGAATGC
521
Ib-F
Ib-R
TAAACGAGAATGGAATATCACAAACC
GAATTAACTTCAATCCCTAAACAATATCG
770
II-F
II-R
GCTTCAGTAAGTATTGTAAGACGATAG
TTCTCTAGGAAATCAAATAATTCTATAGGG
397
III-F
III-R
TCCGTACTACAACAGACTCATCC
AGTAACCGTCCATACATTCTATAAGC
1826
IV-F
IV-R
GGTGGTAATCCTAAGAGTGAACTGT
CCTCCCCAATTTCGTCCATAATGGT
578
V-F
V-R
GAGGCCAATCAGTTGCACGTAA
AACCTTCTCCTTCACACTAATCCT
701
VI-F
VI-R
GGACTTGAGATGGCAGAAGGTGAA
CTGTCGGACTATCCTGATGAATCTC
487
VII-F
VII-R
CCTGGAGAGAACAATGTCCAGAT
GCTGGTCGTGATTTCTACACA
371
VIII-F
VIII-R
AGGTCAACCACTATATAGCGA
TCTTCAAATTCCGCTGACTT
282
  1. (Adopted from Poyart et al., 2007) [38]