Skip to main content

Table 1 Oligonucleotide primers and probe for LF-RPA assay

From: Development of a lateral flow recombinase polymerase amplification assay for rapid and visual detection of Cryptococcus neoformans/C. gattii in cerebral spinal fluid

Name Sequence (5’→3’)
CM ITS P4 FITC-TACACAAACTTCTAAATGTAATGAATGTAATC(H)TATTATAACA ATAATAAA-P
CM ITS F4 TGAACTGTTTATGTGCTTCGGCACGTTTTAC
CM ITS R4 Biotin-TCGATGTGGAAGCCAAGAGATCCGTTGTTG
  1. CM: cryptococcal meningitis; ITS: internal transcribed spacer of ribosomal RNA gene; F: forward primer; R: reverse primer; P: probe; FITC: fluorescein isothiocyanate; H: tetrahydrofuran spacer; P: 3’ phosphate to block elongation.