Skip to main content

Table 1 Primers sequence

From: Successful infection of BALB/c mice by a swine hepatitis E virus clone constructed with reverse genetics

Primer ID Sequence (5′~ 3′) Product Length (bp) Reference
S11 AGGCTCCTGGCRTYACTACTG F1 1163 bp 2
S12 GCCYTGGCGAATGCTGTG
A11 GGCCRGGAATGTAATCACG
A12 GCGGCACTGGGCRTAAAACT
HEV-A1 AAAGGAATGAAGAGGCTGGAG F2 1520 bp This study
HEV-A3 GAAAAGTCTGGCCGTGATTAC
HEV-B2 TCCTCAGTAATAGTAAGGGC
HEV-B4 AGGTCGATGGTTACGTTCCC
HEV-C1 TGCCTGTTGGGCTGAGTTTTGATG F3 1394 bp This study
HEV-C3 GCCAGCCATAGCTTGGTTTGAAG
D1R AAGGTCTTGCTCCACGCAGATATC
D3R CTGGAAGAATGTTATACGAGACAC
D2F CTTGTGGAGGCCATGGTGGAGAA F4 1243 bp This study
D4F ATGGTGGAGAAAGGCCAGGAT
ER1 TCACGCCAAGCGGAGCCGAGT
ER2 GAAGGGGTTGGTTGGATGAAT
EF1 TTTCTGGGGTGACCGGGTTGATT F5 1791 bp This study
EF2 CTATATTCATCCAACCAACCCCT
HEV31 CAGGGAGCGCGGAACGCAGAAAAGA
HEV32 TCAATACTCCCGAGTTTTACCCACC
5' Race-A1 GCAGTGARTARAGYGCAAYCCCHGTCT 5' RACE 501 bp 2
5' Race-A2 CGRGCCATYGCCTCNGCRACATC
3' Race-S1 ACYACNACTGCTGCYACACGBTTYATGA 3' RACR 936 bp 2
3' Race-S2 CTYTGTTYAAYCTTGCTGAYACGCTKCTC
T7P1 GCCTAGCTAGCTAGTCTAGATAATACGACTCACTATA 5′ terminal This study
PAP2 CGGTCGACCGATCGATTTTTTTTTTTTTTTTTTTTTTTTTCAGGGAGCGC 3′ terminal This study
HEV1 AATTATGCC(T)CAGTAC(T)CGG(A)GTTG Positive strand of HEV RNA 348 bp [23]
HEV2 CCCTTA(G)TCC(T)TGCTGA(C)GCATTCTC
HEV3 GTT(A)ATGCTT(C)TGCATA(T)CATGGCT
HEV4 AGCCGACGAAATCAATTCTGTC
HEV6 AGCTCCTGTACCTGATGATGTTGACTC Negative strand of HEV RNA 266 bp [24]
HEV7 CTACAGAGCGCCAGCCTTGATTGC
HEV8 GCTCACGTCATCTGTCGCTGCTGG
HEV9 GGGCTGAACCAAAATCCTGACATC
WHO-F GGTGGTTTCTGGGGTGAC qRT-PCR 70 bp [25]
WHO-R AGGGGTTGGTTGGATGAA
\