Skip to main content

Table 1 K13- propeller primers sequences

From: No polymorphisms in K13-propeller gene associated with artemisinin resistance in Plasmodium falciparum isolated from Brazzaville, Republic of Congo

Primer name Sequences
5′……………………………………………3′
Size (bp)
K13–1(forward) CGGAGTGACCAAATCTGGGA 2097
K13–4 (reverse) GGGAATCTGGTGGTAACAGC
K13-inF2 (forward) TCAACAATGCTGGCGTATGTG 501
K13-inR2 (reverse) TGATTAAG GTAATTAAAAGCTGCTCC