Skip to main content

Table 3 Primers and the amplicon sequence of 5KST-PCR

From: Modified genome comparison method: a new approach for identification of specific targets in molecular diagnostic tests using Mycobacterium tuberculosis complex as an example

Forward 5’-TTGCTGAACTTGACCTGCCCGTA
Reverse 5’-GCGTCTCTGCCTTCCTCCGAT
Amplicon 5’TTGCTGAACTTGACCTGCCCGTAGCCACGGGTTCCGCTGCCGCCGAGGTAGTCGAGTTCGAGCAACTTCAGGCCGCGCGCGATGGCGTTGAAGTCCTCGATGATCTCATCGGAGGAAGGCAGAGACGC
\