Skip to main content

Table 1 Primers used in this study

From: MDR1 overexpression combined with ERG11 mutations induce high-level fluconazole resistance in Candida tropicalis clinical isolates

Gene DNA sequence (5′ to 3′) Amplicon size (bp) Reference
ERG11 for amplification F:TGAAGAATATCCCACAGGCT 1846 This study
R:CTTAGCAAGAACTTCTAATGTT   
ERG11 for RT-PCR F:GAGATTTGATTGATTCCTTGTTGGT 163 This study
R:TGTGGTTGTTCAGCCAAATGC   
CDR1 F:CCAGAGGTTTGGATTCCGCT 186 This study
R:TGGCTTTGTCTGCTTTCCCA   
MDR1 F:GGGTGCATCATTCCAGCCTA 189 This study
R:GGGATGGCAATCATCACGAG   
UPC2 F:GAGTGGAACAACAACACAACAA 208 This study
R:TAAATCCCCTAAACCTGAAAGA   
ACT1 F:TTTACGCTGGTTTCTCCTTGCC 322 [14]
R:GCAGCTTCCAAACCTAAATCGG