Skip to main content

Table 1 Primers used in polymerase chain reaction analysis

From: High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil

Gene Description Primer Sequence (5′- 3′) PCR product Reference
aggR Transcriptional activator CTAATTGTACAATCGATGTA
ATGAAGTAATTCTTGAAT
308 bp [37]
aap Antiaggregation protein CTTTTCTGGCATCTTGGGT
GTAACAACCCCTTTGGAAGT
232 bp [37]
aggA AAF/I fimbria subunit TTAGTCTTCTATCTAGGG
AAATTAATTCCGGCATGG
450 bp [37]
aafA AAF/II fimbria subunit ATGTATTTTTAGAGGTTGAC
TATTATATTGTCACAAGCTC
518 bp [37]
agg-3A AAF/III fimbria subunit GTATCATTGCGAGTCTGGTATTCAG
GGGCTGTTATAGAGTAACTTCCAG
462 bp [38]
had AAF/IV fimbria subunit TCCATTATGTCAGGCTGCAA
GGCGTTAACGTCTGATTTCC
411 bp [41]
paa Porcine AE/associated adhesin ATGAGGAACATAATGGCAGG
TCTGGTCAGGTCGTCAATAC
357 bp  
aida/aah AIDA-I adhesin TCGATACCGAAACGCATACGCAGA
ACGCCGATCGGTGATGATGAAGAT
204 bp  
afaE Afa-I afimbrial adhesin CGAAAACGGCACTGACAAG
AGGCTTTCCGTGAATACAACC
230 bp [34]
daaE F1845 fimbrial adhesin TGACTGTGACCGAAGAGATGC
TTAGTTCGTCCAGTAACCCCC
380 bp [34]
sat Secreted autotransporter toxin CTCATTGGCCTCACCGAACGG
GCTGGCAGCTGTGTCCACGAG
299 bp  
pic Serine protease precursor ACTGGCGGACTCATGCTG T
AACCCTGTAAGAAGACTGAGC
387 bp  
pet Plasmid-encoded toxin GACCATGACCTATACCGACAGC
CCGATTTCTCAAACTCAAGACC
600 bp  
astA EAST1 heat-stable toxin CCATCAACACAGTATATCCGA
GGTCGCGAGTGACGGCTTTGT
111 bp  
chuA/ shuA Heme receptor ATCTGCTGCGTCATGTTCCT
GTAGTGGTCATACCTTTGAGC
1700 bp  
iucA Aerobactin sintase AGTCTGCATCTTAACCTTCA
CTCGTTATGATCGTTCAGAT
1100 bp  
irp2 Iron chelating AAGGATTCGCTGTTACCGGAC
TCGTCGGGCAGCGTTTCTTCT
264 bp