Skip to main content

Advertisement

Table 2 Primer and probe sequences used in the CDC and PAHO RT-qPCR assays

From: Evaluation of a field-deployable reverse transcription-insulated isothermal PCR for rapid and sensitive on-site detection of Zika virus

Name Sequence (5′ to 3′) Target Positiona Function Reference
ZIKV914prM TTGGTCATGATACTGCTGATTGC prM nt914–936 RT-qPCR forward primer Lanciotti et al. [17]
ZIKV990prMc CCTTCCACAAAGTCCCTATTGC prM nt990–969 RT-qPCR reverse primer Lanciotti et al., [17]
ZIKV965prMFAM FAM-CGGCATACAGCATCAGGTGCATAGGAG-TAMRA prM nt939–965 RT-qPCR forward probe Lanciotti et al., [17]
ZIKV1165E CCGCTGCCCAACACAAG E nt1165–1181 RT-qPCR forward primer Lanciottiet al., [17]
ZIKV1241Ec CCACTAACGTTCTTTTGCAGACAT E nt1241–1218 RT-qPCR reverse primer Lanciotti et al., [17]
ZIKV1216HEX HEX-AGCCTACCTTGACAAGCARTCAGACACTCAA-BHQ1 E nt1186–1216 RT-qPCR forward probe Lanciotti et al., [17]
ZIKV4513NS2B CTGTGGCATGAACCCAATAG NS2B nt4513–4532 RT-qPCR forward primer Waggoner and Pinsky, [43]
ZIKV4603NS2Bc ATCCCATAGAGCACCACTCC NS2B nt4603–4584 RT-qPCR reverse primer Waggoner and Pinsky, [43]
ZIKV4558cFAM FAM-CCACGCTCCAGCTGCAAAGG-TAMRA NS2B nt4558–4539 RT-qPCR probe Waggoner and Pinsky, [43]
  1. aNucleotide position is based on ZIKV PRVABC59 strain (Puerto Rico, 2015), GenBank accession number KX087101.2