Skip to main content

Table 2 Primers used for PCR amplification of ITS gene

From: Infection by and genotype characteristics of Enterocytozoon bieneusi in HIV/AIDS patients from Guangxi Zhuang autonomous region, China

Primer name Primer sequence(5′-3′) Fragment size
ITSF1 GATGGTCATAGGGATGAAGAGCTT  
ITSR1 AATACAGGATCACTTGGATCCGT ~410
ITSF2 AGGGATGAAGAGCTTCGGCTCTG
ITSR2 AATATCCCTAATACAGGATCACT ~390