Skip to main content

Table 1 Specific primers of EgTPX, EgEPC1 and EgHSP70

From: Effects of X-ray on the metacestodes of Echinococcus granulosus in vitro

Gene Primers (5′-3′) Product size
EgTPX F: TTTCTTAGATAAGCTCGACTCCAA
R: AGTATATAGACCGGTGAATTAAGGG
196 bp
EgHSP70 F: GAGGAGTTGTGTTCGGACCT
R: GTCCGGGTTTATCGACTTGT
145 bp
EgEPC1 F: TTTCTTAGATAAGCTCGACTCCAA
R: AGTATATAGACCGGTGAATTAAGGG
151 bp
Actin F: TCAATCCTAAAGCCAATC
R: CGTACAACGACAGCAC
163 bp