Skip to main content

Table 1 Primers for polymerase chain reaction amplification and sequencing

From: Early detection of multidrug- and pre-extensively drug-resistant tuberculosis from smear-positive sputum by direct sequencing

Gene Primer Sequence Size (bp)
rpoB Forward CCACCCAGGACGTGGAGGCGATCACACCG 329
Reverse CGTTTCGATGAACCCGAACGGGTTGAC
katG Forward GGGGCTGATCTACGTGAACC 363
Reverse CTCTTCGTCAGCTCCCACTC
inhA promoter Forward ATGGAAGGCAGAAGCCGAGTA 398
Reverse GACTGAACGGGATACGAATGG
gyrA Forward CAGCGCAGCTACATCGACTA 356
Reverse CTCAGCATCTCCATCGCCAA