Skip to main content

Table 1 List of primer sequences used for RT-PCR analysis

From: Anti-hepatitis B virus (HBV) response of imiquimod based toll like receptor 7 ligand in hbv-positive human hepatocelluar carcinoma cell line

Gene FORWARD PRIMER REVERSE PRIMER
IRAK 1 5'-ACCGCAGATTATCATCAACC-3' 5'-AGACTTACAGCCATACTTCACT-3'
IRAK 4 5'-GCTGTATGTAGGGTGGAAAC-3’ 5'-TGCTGACAACTGGAAGGTAG-3'
TRAF6 5'-GCCCAGGCTGTTCATAGTTT-3' 5'-CAAGGGAGGTGGCTGTCATA-3'
p53 5’-CCCAAGCAATGGATGATTTGA-3’ 5’-GGCATTCTGGGAGCTTCATCT-3’
CYCLIN D1 5’-AGCTCCTGTGCTGCGAAGTGGAAAC-3’ 5’-AGTGTTCAATGAAATCGTGCGGGGT-3’
CYCLIN E 5’-CAGCACTTTCT TG AGCAACACCCTC-3’ 5’-TCTCTAT GTCGCACCACTGATACCC-3’
CYCLIN B1 5’-AAGAGCTTTAAACTTTGGTCTGGG-3’ 5’-CTTTGTAAGTCCTTGATTTACCATG-3’
CYCLIN A 5’GCATGTCACCGTTCCTCCTT-3’ 5’CAGGGCATCTTCACGCTCTAT-3’
JNK 5'- GTACTTGTATGAAACCACCTTTCT -3' 5'- AGCATCTCTTTCTGAATCTATGAAG -3'
PI3KCA 5'- AAGGGTGCTAAAGAGGAACAC -3’ 5'-CATGAGGTACTGGCCAAAGAT -3'
PI3KCB 5'- CTCCAAATGTTGCGCTTGATG -3' 5'- ACAACTTCAATGAGGCCAGAG -3'
PI3KCG 5’- CACCGAGACAGGAAACCTATTT -3’ 5’- TAGCACAAATGGCACTCTCTC -3’
NF-КB 5’-CGCATCCAGACCAACAACA-3’ 5’- TGCCAGAGTTTCGGTTCAC-3’
p38 5’- TCTGCTTACCCTTCACCTTTG -3’ 5’- CACATCCTCACTCTGCTAGAAAT -3’
c-jun 5’-CAAAGTTTGGATTGCATCAATG-3’ 5’- TAACATTATAAATGGTCACAGCACATG-3’
c-myc 5’-CTTCTCTCCGTCCTCGGATTCT-3’ 5’-GAAGGTGATCCAGACTCTGACCTT-3’
Sap-1 5’-GCTTTTGCCACCACACCACCCATTTCG-3’ 5’-GCCCAGACAGAGTGAATGGCCCATGAC-3’
Elk-1 5’-ACCTGAAATCGGAAGAGCTTAAT-3’ 5’-AACTTCCAACTCTTCCTTGGG-3’
TNF-α 5’-ATGGGCTACAGGCTTGTCACT-3’ 5’-CTCTTGGCAGCCTTCCTGATT-3’
IFN-β 5’-GTCTCCTCCAAATTGCTCTC-3’ 5’-ACAGGAGCTTCTGACACTGA-3’
IFN-α 5’-TGGCTGTGAAGAAATACTTCCG-3’ 5’-TGTTTTCATGTTGGACCAGATG-3’
IL-6 5’-ATGTAGCCGCCCCACACAGA-3’ 5’-CATCCATCTTTTTCAGCCAT-3’
IL-1β 5’-ACAGATGAAGTGCTCCTTCCA-3’ 5’-GTCGGAGATTCGTAGCTGGAT-3’
GAPDH 5'-AAGGCTGTGGGCAAGG-3' 5'-TGGAGGAGTGGGTGTCG-3'