Skip to main content

Table 1 Primer sequences and annealing temperatures used for PCR and sequencing

From: Mechanisms of first-line antimicrobial resistance in multi-drug and extensively drug resistant strains of Mycobacterium tuberculosis in KwaZulu-Natal, South Africa

Gene Primer Nucleotide Sequence
(5′ → 3′)
Annealing Temp (°C) Associated Drug Resistance Ref
rpoB rpoB F TGTTGGACATCTACCGCAAG 54 °C Rifampicin *
rpoB R CGAGACGTCCATGTAGTCCA
inhA inhA F CTACATCGACACCGATATGAC 55 °C Isoniazid [26]
inhA R GACCGTCATCCAGTTGTAG
katG katG F GGTCGACATTCGCGAGACGTT 57 °C Isoniazid [27]
katG R TTGTTCCTGCGACGCATCGTG
pncA pncA F GCTGGTCATGTTCGCGATCG 59 °C Pyrazinamide [28]
pncA R GCTTTGCGGCGAGCGCTCCA
embB embB F AAGCTGGCGCACCTTCAC 55 °C Ethambutol *
embB R ATAGCGCGGTGATCAAAAA
  1. * newly designed primers