Skip to main content

Table 2 Primer sequences for PCR of ChIP

From: PU.1 is involved in the immune response to Aspergillus fumigatus through upregulating Dectin-1 expression

Primers Sequence (5′–3′)
hDectin-1-A- Forward CTTTTCCTTAGCAAACTCCACT
hDectin-1-A-Reverse TCAGTAATACTATTGCAACAGGA
hDectin-1-B- Forward CCTTCCATAAGCTGTTCCTTGCA
hDectin-1-B-Reverse CAAGGAATCAAATCAAAGCTGACTC
hDectin-1-C- Forward GCCTACTATATAGACTTGGAAAAG
hDectin-1-C-Reverse CTTTGGGAATTATCAGATATTAACAC
hDectin-1-D- Forward AGCCGAGATCGTGCCATTTGCA
hDectin-1-D-Reverse TGCTTCTCAAAGGGCAGAGAAAGA
hDectin-1-E- Forward GAGTCAGCTTTGATTTGATTCCTTG
hDectin-1-E-Reverse ACTTTTCCAAGTCTATATAGTAGGC