Skip to main content

Table 1 DPO primers used for multiplex DPO PCR

From: A multiplex PCR assay for the detection of five influenza viruses using a dual priming oligonucleotide system

Virus Target gene Primer sequence (5′–3′) Amplicon size (bp)
H1N1 pdm09 HA F:TAGTGCTGACCAACAAAGTCTCTAIIIIIATGCAG 231
R:GCATTTCTTTCCATTGCGAATGCIIIIITCGGTAC
sH1N1 HA F:TGCGAATYACTGATTTCCAAGGAIIIIIGGTCCTA 193
R: CTCCGGTTACRGTGTGGTGGGGIIIIIAGCTCTCT
H3N2 HA F:ACGCTGTGCCTTGGGCACCATGCAIIIIIAAACGG 537
R:GTCMTTGTCCGTACCCGGGTGGTGIIIIICCCAAA
H5N1 HA F:GAGAGATTGTAGTGTAGCTGGATIIIIICTCGGAA 328
R:CTTTATTGTTGGGTATGTRCTGTTIIIIITGATAAGCC
FluB PB1 F:TTGGCTATGACTGAAAGAATAACCAIIIIIAGCCCA 401
R:GCATTAACAAATAGAGCAAAATCATIIIIIGATTGC
  1. HA: hemagglutinin gene; PB1:polymerase basic 1 gene; F: forward primer; R: reverse primer; bp: base pair.