Skip to main content

Table 1 Oligonucleotide primers, probes and internal control sequences

From: Detection and serotyping of pneumococci in community acquired pneumonia patients without culture using blood and urine samples

Assay Name Sequence
qPCR Sp-ply-531 F1 AGCGATAGCTTTCTCCAAGTGG
  Sp-ply-583R1 CTTAGCCAACAAATCGTTTACCG
  Sp-lytA-306 F1 ACGCAATCTAGCAGATGAAGC
  Sp-lytA-386R1 TGTTTGGTTGGTTATTCGTGC
  Sp-lytA-CDCF2 ACGCAATCTAGCAGATGAAGCA
  Sp-lytA-CDCR2 TCGTGCGTTTTAATTCCAGCT
  Sp-ply-556probe1 FAM-ACCCCAGCAATTCAAGTGTTCGCG-BHQ1
  Sp-lytA330-probe1 Cy5-TTTGCCGAAAACGCTTGATACAGGG-BHQ3
  Sp-lytA-CDCprobe2 FAM-GCCGAAAACGCTTGATACAGGGAG-BHQ1
  Sp-lytA-probe2 FAM-TTTGCCGAAAACGCTTGATACAGGG-TAMRA
  Sp-Spike-qPCR3 ACGCAATCTAGCAGATGAAGCTATCATGGCGACGTGTTTCATGCAGATATATCGGTAAACGATTTGTTGGCTAAG
  Sp-spike-probe3 HEX-CATGGCGACGTGTTTCATGCAGATA-BHQ1
Clinical CST CST_01-M13F GTAAAACGACGGCCAGCATTCGCATATCGTTTTTG
  CST_03-M13F GTAAAACGACGGCCAGCATTCGCACATCGTCTTTG
  M13wzh1553F GTAAAACGACGGCCAGACCATTGTCTCTACCTCTCAC
  M13wzh1553Fst3 GTAAAACGACGGCCAGATGATTGTGTCTACTTCGCAT
  M13wzh1747R CAGGAAACAGCTATGACATCAAGGCATAACGACTATCA
  CST_01-M13R CAGGAAACAGCTATGACCTGAGCTCTTTTTTTCATGA
  CST_04-M13R CAGGAAACAGCTATGACCCGAGCTCTCTTTTTCATGA
  M13F GTAAAACGACGGCCAG
  M13R CAGGAAACAGCTATGAC
  1. 1used in the general study [8,35].
  2. 2used in the comparison sample set [40].
  3. 3DNA sequence used for internal control of the qPCR.