Skip to main content

Table 1 Oligonucleotide primers and hybridization probes used in this study

From: Evaluation of a novel real-time PCR test based on the ssrAgene for the identification of group B streptococci in vaginal swabs

Name Function Sequence 5' - 3'
gbsU3F Forward primer GACAGGCATTATGAGGTA
gbsU4R Reverse primer GCTAATATATTTGTCTACAAC
CompF Forward composite primer for IAC generation GACAGGCATTATGAGGTAATACCCAACTTGGAATG
CompR Reverse composite primer for IAC generation GCTAATATATTTGTCTACAACTCTTCACCAGAATAAAATTG
tmUF Universal bacterial ssrA forward primer GGGG(A/C)(C/T)TACGG(A/T)TTCGAC
tmUR Universal bacterial ssrA reverse primer GGGA(A/G)TCGAACC(A/G)(C/G)GTCC
f1GBS-Flu GBS-specific hybridization probe TTGCGTTTTGCTAGAAGGTCTTA - Flu
f2GBS-LC640 GBS-specific hybridization probe LC640- TATCAGCAAACTACGTTTGGCT - Ph
ALS1-Flu IAC-specific hybridization probe TGAATGTATCCCCTGGA - Flu
ALS1-LC705 IAC-specific hybridization probe LC705 - TGGCACTGGTACCATCTAA - Ph