Skip to main content

Table 1 Primers used in this evaluation.

From: Truncation in the tcdC region of the Clostridium difficilePathLoc of clinical isolates does not predict increased biological activity of Toxin B or Toxin A

Sequence primer Gene Reference
AAAGAAGCTACTAAGGGTACAAA tpi-F tpi [26]
CATAATATTGGGTCTATTCCTAC tpi-R   [26]
AGATTCCTATATTTACATGACAATAT tcdA-F tcdA [26]
GTATCAGGCATAAAGTAATATACTTT tcdA-R   [26]
AATGCATTTTTGATAAACACATTG tcdB-3 tcdB this study
AAGTTTCTAACATCATTTCCAC tcdB-4   this study
TCTCTACAGCTATCCCTGGT PaL15 tcdC [12]
AAAAATGAGGGTAACGAATTT Pal16   [12]
TTTCATACATTTGTGCTGGG cdd1-A tcdC this study
AATGCATTTTTGATAAACACATTG tcdC-3   this study
TTCTAGATTTCATAAAAGATAC TPR-1 tcdR this study
CTGACATATTATGATATTCTTC tcdB-UP   this study
GTTGTTTAGATTTAGATGAAAAGA Lok6 tcdE [33]
CTTGGTCTAATGCTATATGCGAG PrimexA   [34]
CTTAATGCAAGTAAATACTGAG cdtB-pos cdtB [24]
AACGGATCTCTTGCTTCAGTC cdtB-rev   [24]