Skip to main content

Table 1 Primers of biomarkers, and their source, PCR conditions, and expected size.

From: Brain injury-associated biomarkers of TGF-beta1, S100B, GFAP, NF-L, tTG, AbetaPP, and tau were concomitantly enhanced and the UPS was impaired during acute brain injury caused by Toxocara canisin mice

Targets

Primer sequence 5'-3'

Annealing temperature

Cycle number

Expected size (bp)

Reference

TGF-β1

sens-AGACGGAATACAGGGCTT TCGATT CA

55°C

35

492

[73]

 

antisens-CTTGGGCTTGCGACCCAGTAGTA

    

GFAP

sens-GAATGGCCACTAAGGCAGTC

58°C

35

400

[74]

 

antisens-TGCACTCCCTCTCTCCTGTT

    

S100B

sens-GACTCCAGCAGCAAAGGTGAC

58°C

35

211

[75]

 

antisens-CATCTTCGTCCAGCGTCTCCA

    

tTG

sens-AGGCCAACCACCTGAACAAA

60°C

35

475

[76]

 

antisens-CATACAGGGGATCGGAAAGT

    

NF-L

sens-AGCAGAATGCAGACATTAGCG CC

57°C

38

200

[77]

 

antisens-TGGTCTCTTCGCCTTCC AAGA GT

    

AβPP69

sens-GCACTAACTTGCACGACTAT GGCATGCTGCTGCCCTG

70°C

35

401

 
 

antisens-GCTGGCTGCCGTCGTGG GAACTCGGACTACCTCCTCCAC A

    

AβPP75 1

sens-CTACCACTGAGTCTGTGGAG

64°C

45

222

[50]

 

antisens-GCTGGCTGCCGTCGTGG GAAACACGCTGCCACACACCGC C

    

AβPP77 0

sens-CTACCACTGAGTCTGTGGAG

64°C

45

242

 
 

antisens-CTTGAGTAAACTTTGGGA TGACACGCTGCCACACACCGCC

    

GAPDH

sens-ACCACAGTCCATGCCATCAC

60°C

27

452

[75]

 

antisens-TCCACCACCCTGTTGCTG TA