Skip to main content

Table 1 Primers of biomarkers, and their source, PCR conditions, and expected size.

From: Brain injury-associated biomarkers of TGF-beta1, S100B, GFAP, NF-L, tTG, AbetaPP, and tau were concomitantly enhanced and the UPS was impaired during acute brain injury caused by Toxocara canisin mice

Targets Primer sequence 5'-3' Annealing temperature Cycle number Expected size (bp) Reference
TGF-β1 sens-AGACGGAATACAGGGCTT TCGATT CA 55°C 35 492 [73]
  antisens-CTTGGGCTTGCGACCCAGTAGTA     
GFAP sens-GAATGGCCACTAAGGCAGTC 58°C 35 400 [74]
  antisens-TGCACTCCCTCTCTCCTGTT     
S100B sens-GACTCCAGCAGCAAAGGTGAC 58°C 35 211 [75]
  antisens-CATCTTCGTCCAGCGTCTCCA     
tTG sens-AGGCCAACCACCTGAACAAA 60°C 35 475 [76]
  antisens-CATACAGGGGATCGGAAAGT     
NF-L sens-AGCAGAATGCAGACATTAGCG CC 57°C 38 200 [77]
  antisens-TGGTCTCTTCGCCTTCC AAGA GT     
AβPP69 sens-GCACTAACTTGCACGACTAT GGCATGCTGCTGCCCTG 70°C 35 401  
  antisens-GCTGGCTGCCGTCGTGG GAACTCGGACTACCTCCTCCAC A     
AβPP75 1 sens-CTACCACTGAGTCTGTGGAG 64°C 45 222 [50]
  antisens-GCTGGCTGCCGTCGTGG GAAACACGCTGCCACACACCGC C     
AβPP77 0 sens-CTACCACTGAGTCTGTGGAG 64°C 45 242  
  antisens-CTTGAGTAAACTTTGGGA TGACACGCTGCCACACACCGCC     
GAPDH sens-ACCACAGTCCATGCCATCAC 60°C 27 452 [75]
  antisens-TCCACCACCCTGTTGCTG TA