Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primers and MGB-probe designed in this work

From: A sensitive one-step real-time PCR for detection of avian influenza viruses using a MGB probe and an internal positive control

NAME SEQUENCE (5'-3') LOCATION (nt) SENSE
M-Flu1 CTTCTAACCGAGGTCGAAACGTA 32–54 +
M-Flu2 GGATTGGTCTTGTCTTTAGCCA 158–179 -
M-Fluprob FAM-CTCGGCTTTGAGGGGGCCTGA-MGB 74–94 -