Skip to main content

Table 1 List of primers employed in the study.

From: HIV-1 subtype A infection in a community of intravenous drug users in Pakistan

Primer Sequence
PC03 ACACAACTGTGTTCACTAGC
PC04 CAACTTCATCCACGTTCACC
JA9AE CACAGTACAATGCACACATG
JA9B CACAGTACAATGTACACATG
JA12A GCAATAGAAAAATTCTCCTC
JA12B ACAGTAGAAAAATTCCCCTC
JA10UB CTGTTAAATGGCAGTCTAGC
JA10UC CTGTTAAATGGTAGTCTAGC
JA10UG CTGTTAAATGGCAGTTTAGC
JA11LAE AATTTCTAGATCCCCTCCTG
JA11LB AATTTCTGGGTCCCCTCCTG
JA11LC AATTTCTAGGTCCCCTCCTG
JA11QA CCCCTCCTGAGGAGTTAGCA
JA11VB CACAATTAAAACTGTGCATTACAA
JA11XC TTGTTTTATTAGGGAAGTGTTC
JA11YE AAATTCCCCTCTACAATTAAAATGA
Primers used in gag HMA
HIG777 TCACCTAGAACTTTGAATGCATGGG
H1P0202 CTAATACTGTATCATCTGCTCCTGT
H1Gag1584 AAAGATGGATAATCCTGGG
g17 TCCACATTTCCAACAGCCCTTTT
  1. PC03/PC04 primers for β-Globin, JA9AE, JA9B are the upstream primers and JA12A, JA12B are the downstream primer for the first round PCR. JA10UB, JA10UC and JA10UG are the inner upstream primers; JA11LAE, JA11LB and JA11LC are the inner downstream general primers. JA11QA, JA11VB, JA11XC and JA11YE are the inner downstream subtype specific primers for subtypes A, B, C and CRF01-AE, respectively.
  2. Primers for gag HMA are relative to HIV-1 group M strain ELI (GenBank accession number K03454)