Skip to main content

Table 1 Primers used for PCR to detect Shigella resistance and virulence genes

From: Epidemic and virulence characteristic of Shigella spp. with extended-spectrum cephalosporin resistance in Xiaoshan District, Hangzhou, China

Primer Sequence (5′-3′) Amplicon size (bp) Reference
ESBL genes
CTX-M-1 group F-GGCCCATGGTTAAAAAATCACTGC 891 [3]
  R-CCGTTTCCGCTATTACAAACCGTTG  
CTX-M-2 group F-CTCAGAGCATTCGCCGCTCA 843
  R-CCGCCGCAGCCAGAATATCC  
CTX-M-8 group F-ATGATGAGACATCGCGTTAAC 864
  R-CGGTGACGATTTTCGCGGCAG  
CTX-M-9 group F-GTGACAAAGAGAGTGCAACGG 856
  R-ATGATTCTCGCCGCTGAAGCC  
OXA group F-ACACAATACATATCAACTTCGC 813
  R-AGTGTGTTTAGAATGGTGATC  
SHV group F-GCCTTTTCGGCCTTCACTCAAG 989
  R-TTAGCGTTGCCAGTGCTCGATCA  
TEM group F-ATAAAATTCTTGAAGACGAAA 1076
  R-GACAGTTACCAATGCTTAATC  
AmpC β-lactamase genes
MOX group F-GCTGCTCAAGGAGCACAGGAT 520 [14]
  R-CACATTGACATAGGTGTGGTGC  
CIT group F-TGGCCAGAACTGACAGGCAAA 462
  R-TTTCTCCTGAACGTGGCTGGC  
DHA group F-AACTTTCACAGGTGTGCTGGGT 405
  R-CCGTACGCATACTGGCTTTGC  
ACC group F- AACAGCCTCAGCAGCCGGTTA 346
  R- TTCGCCGCA ATCATCCCTAGC  
EBC group F- TCGGTAAAGCCGATGTTGCGG 302
  R- CTTCCACTGCGGCTGCCAGTT  
FOX group F- AACATGGGGTATCAGGGAGATG 190
  R- CAA AGCGCGTAACCGGATTGG  
Virulence gene
ial F-CTGGATGGTATGGTGAGG 320 [12]
  R-GGAGGCCAACAATTATTTCC  
ipaH F-TGGAAAAACTCAGTGCCTCT 423
  R-CCAGTCCGTAAATTCATTCT  
setlA F-TCACGCTACCATCAAAGA 309
  R-TATCCCCCTTTGGTGGTA  
setlB F-GTGAACCTGCTGCCGATATC 147
  R-ATTTGTGGATAAAAATGACG  
sen F-ATGTGCCTGCTATTATTTAT 799
  R-CATAATAATAAGCGGTCAGC  
virA F-CTGCATTCTGGCAATCTCTTCACATC 215 [13]
  R-TGATGAGCTAACTTCGTAAGCCCTCC