Skip to main content

Table 1 Primers and probes for multiplex qPCR

From: Multiplex qPCR for reliable detection and differentiation of Burkholderia mallei and Burkholderia pseudomallei

Organism Target Oligo function Oligo name Sequence 5'-3' a
B. pseudomallei + ISBma2 primer Bumcpri_f GCGGAAGCGGAAAAAGGG
B. mallei ISBma2transposase primer Bumcpri_r GCGGGTAGTCGAAGCTG
   probe Tqpro_Bumc FAM-TCRCCAGACGCAGCAGCAT-BHQ1
B. pseudomallei Hypothetical primer psupri_f GCGCGATCCGTCGAG
  protein primer psupri_r AGCCGCTACGACGATTATG
   probe Tqpro_psu JOE-CCGCGACAATACGACCATCC-BHQ1
B. mallei Hypothetical primer maupri3_f GGCGAAAGAACGCGAAC
  protein primer maupri3_r GCGTTCCACGATCAACTCT
   probe Tqpro2_mau CF590-CATCCCGCACCGTCCG-BHQ2
B. thuringiensis Crystal protein primer Btpri_f GCAACTATGAGTAGTGGGAGTAATTTAC
  gene primer Btpri_r TTCATTGCCTGAATTGAAGACATGAG
   probe Tqpro_Bt Cy5-ACGTAAATACACT-BHQ2-TGATCCATTTGAAAAG-P
  1. a CFR590= CalFluor Red 590, BHQ= Black Hole quencher, P= phosporylation.